![]() | 21 |
![]() ![]() | ICEVchInd4 ![]() |
![]() ![]() | ICEO_0000012 |
![]() | Vibrio cholerae O139 Ind4 |
![]() | 95326 |
![]() | 46.87 |
![]() | prfC |
![]() | Antibiotic resistance genes: floR, strBA, sul2; Toxin-antitoxin system |
![]() | - |
![]() | GQ463141 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..95326 |
![]() ![]() | coordinates: 3489..3595; oriTDB id: 200056 TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA |
![]() ![]() | coordinates: 40986..43136; Locus tag: ICEVCHIND4_0034; Family: MOBH |
The graph information of ICEVchInd4 components from GQ463141 | |||||
![]() | |||||
Complete gene list of ICEVchInd4 from GQ463141 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | ICEVCHIND4_0001 | 419..613 [+], 195 | conserved domain protein | ||
2 | ICEVCHIND4_0002 | 630..1871 [-], 1242 | integrase | Integrase | |
3 | ICEVCHIND4_0003 | 1873..2142 [-], 270 | conserved hypothetical protein | ||
4 | ICEVCHIND4_0004 | 2145..3119 [-], 975 | conserved hypothetical protein | ||
5 | ICEVCHIND4_0005 | 3215..3382 [+], 168 | hypothetical protein | ||
6 | ICEVCHIND4_0006 | 3584..4027 [+], 444 | conserved hypothetical protein | ||
7 | ICEVCHIND4_0007 | 4038..5210 [-], 1173 | protein UmuC | ||
8 | ICEVCHIND4_0008 | 5494..6087 [+], 594 | transposase, IS3 family, interruption | ||
9 | ICEVCHIND4_0009 | 6201..9179 [+], 2979 | transposase | ||
10 | ICEVCHIND4_0010 | 9597..11090 [+], 1494 | iscr2 transposase | ||
11 | ICEVCHIND4_0011 | 11121..12005 [+], 885 | conserved hypothetical protein | ||
12 | ICEVCHIND4_0012 | 12222..13436 [+], 1215 | florfenicol/chloramphenicol resistance protein | AR | |
13 | ICEVCHIND4_0013 | 13464..13769 [+], 306 | truncated helix-turn-helix multiple antibiotic resistance protein | ||
14 | ICEVCHIND4_0015 | 13890..14420 [+], 531 | truncated transposase | ||
15 | ICEVCHIND4_0014 | 14392..15222 [-], 831 | streptomycin resistance protein B | AR | |
16 | ICEVCHIND4_0016 | 15228..16031 [-], 804 | streptomycin 3''-kinase | AR | |
17 | folP | 16092..16907 [-], 816 | dihydropteroate synthase | AR | |
18 | ICEVCHIND4_0018 | 17378..18991 [+], 1614 | TnpA | ||
19 | ICEVCHIND4_0019 | 19334..19603 [-], 270 | ultraviolet light resistance protein B | ||
20 | ICEVCHIND4_0020 | 19611..20060 [-], 450 | protein UmuD | ||
21 | ICEVCHIND4_0021 | 20179..20316 [+], 138 | hypothetical protein | ||
22 | ICEVCHIND4_0022 | 20699..21607 [+], 909 | exonuclease, RNase T and DNA polymerase III | ||
23 | ICEVCHIND4_0023 | 21681..21995 [+], 315 | conserved hypothetical protein | ||
24 | ICEVCHIND4_0024 | 22103..22990 [+], 888 | conserved hypothetical protein | ||
25 | ICEVCHIND4_0025 | 23000..23599 [+], 600 | conserved hypothetical protein | ||
26 | ICEVCHIND4_0026 | 23596..24180 [+], 585 | conserved hypothetical protein | ||
27 | ICEVCHIND4_0027 | 24199..27876 [+], 3678 | conserved hypothetical protein | ||
28 | ICEVCHIND4_0028 | 27887..29056 [+], 1170 | conserved hypothetical protein | ||
29 | ICEVCHIND4_0029 | 29053..29811 [+], 759 | conserved hypothetical protein | ||
30 | ICEVCHIND4_0030 | 29815..33387 [+], 3573 | type II restriction enzyme | ||
31 | ICEVCHIND4_0031 | 33387..36044 [+], 2658 | conserved hypothetical protein | ||
32 | ICEVCHIND4_0032 | 36061..38136 [+], 2076 | conserved hypothetical protein | ||
33 | ICEVCHIND4_0033 | 38180..40831 [+], 2652 | DNA repair ATPase | ||
34 | ICEVCHIND4_0034 | 40986..43136 [+], 2151 | conjugative relaxase | Relaxase, MOBH Family | |
35 | ICEVCHIND4_0035 | 43185..45005 [+], 1821 | conjugative coupling factor | TraD_F, T4SS component | |
36 | ICEVCHIND4_0036 | 45015..45575 [+], 561 | conserved hypothetical protein | ||
37 | ICEVCHIND4_0037 | 45562..46197 [+], 636 | putative conjugation coupling factor | ||
38 | ICEVCHIND4_0038 | 46223..46501 [-], 279 | transcriptional regulator, XRE family | ||
39 | ICEVCHIND4_0039 | 46498..46821 [-], 324 | conserved hypothetical protein | ||
40 | traL | 47002..47283 [+], 282 | type IV conjugative transfer system protein TraL | TraL_F, T4SS component | |
41 | ICEVCHIND4_0041 | 47280..47906 [+], 627 | sex pilus assembly | TraE_F, T4SS component | |
42 | ICEVCHIND4_0042 | 47890..48786 [+], 897 | TraK | TraK_F, T4SS component | |
43 | ICEVCHIND4_0043 | 48789..50078 [+], 1290 | sex pilus assembly | TraB_F, T4SS component | |
44 | ICEVCHIND4_0044 | 50075..50725 [+], 651 | sex pilus assembly | TraV_F, T4SS component | |
45 | ICEVCHIND4_0045 | 50722..51108 [+], 387 | TraA | TraA_F, T4SS component | |
46 | ICEVCHIND4_0046 | 51179..52120 [+], 942 | conserved hypothetical protein | ||
47 | ICEVCHIND4_0047 | 52113..53051 [+], 939 | ync | ||
48 | ICEVCHIND4_0048 | 53183..53875 [+], 693 | DsbC | TrbB_I, T4SS component | |
49 | traC | 53875..56274 [+], 2400 | type-IV secretion system protein TraC | TraC_F, T4SS component | |
50 | ICEVCHIND4_0050 | 56267..56614 [+], 348 | conserved hypothetical protein | ||
51 | ICEVCHIND4_0051 | 56598..57110 [+], 513 | conjugation signal peptidase | TraF, T4SS component | |
52 | ICEVCHIND4_0052 | 57121..58245 [+], 1125 | sex pilus assembly | TraW_F, T4SS component | |
53 | ICEVCHIND4_0053 | 58277..59257 [+], 981 | sex pilus assembly | TraU_F, T4SS component | |
54 | ICEVCHIND4_0054 | 59260..62958 [+], 3699 | mating pair stabilization | TraN_F, T4SS component | |
55 | ICEVCHIND4_0055 | 63051..63731 [-], 681 | hypothetical protein | ||
56 | ICEVCHIND4_0056 | 63738..64823 [-], 1086 | conserved hypothetical protein | ||
57 | ICEVCHIND4_0057 | 64823..65887 [-], 1065 | conserved hypothetical protein | ||
58 | ICEVCHIND4_0058 | 66000..66683 [-], 684 | endonuclease-1 (Endonuclease I) (Endo I) | ||
59 | ICEVCHIND4_0059 | 66816..67418 [-], 603 | conserved hypothetical protein | ||
60 | ICEVCHIND4_0060 | 67655..67786 [-], 132 | hypothetical protein | ||
61 | ICEVCHIND4_0061 | 67786..68112 [+], 327 | conserved hypothetical protein | ||
62 | ICEVCHIND4_0062 | 68128..68547 [+], 420 | single-strand binding protein family | ||
63 | ICEVCHIND4_0063 | 68627..69445 [+], 819 | phage recombination protein Bet | ||
64 | ICEVCHIND4_0064 | 69527..69670 [+], 144 | hypothetical protein | ||
65 | ICEVCHIND4_0065 | 69731..70747 [+], 1017 | YqaJ viral recombinase family | ||
66 | ICEVCHIND4_0066 | 70957..71916 [+], 960 | ATPase associated with various cellular activities, AAA_5 | ||
67 | ICEVCHIND4_0067 | 71919..72683 [+], 765 | conserved hypothetical protein | ||
68 | ICEVCHIND4_0068 | 72782..73735 [+], 954 | conserved hypothetical protein | ||
69 | ICEVCHIND4_0069 | 73797..74237 [+], 441 | conserved hypothetical protein | ||
70 | ICEVCHIND4_0070 | 74307..75962 [+], 1656 | von Willebrand factor, type A | ||
71 | radC | 76044..76541 [+], 498 | DNA repair protein RadC | ||
72 | ICEVCHIND4_0072 | 76541..76882 [+], 342 | conserved hypothetical protein | ||
73 | ICEVCHIND4_0073 | 76974..78047 [+], 1074 | phage P4 alpha, zinc-binding domain protein | ||
74 | ICEVCHIND4_0074 | 78138..78845 [+], 708 | conserved hypothetical protein | ||
75 | ICEVCHIND4_0075 | 79108..80037 [-], 930 | response regulator receiver protein | ||
76 | ICEVCHIND4_0076 | 80043..83849 [-], 3807 | multi-sensor hybrid histidine kinase | ||
77 | ICEVCHIND4_0077 | 83840..83956 [+], 117 | hypothetical protein | ||
78 | ICEVCHIND4_0078 | 84584..85528 [+], 945 | conserved hypothetical protein | TraF_F, T4SS component | |
79 | ICEVCHIND4_0079 | 85531..86919 [+], 1389 | sex pilus assembly | TraH_F, T4SS component | |
80 | ICEVCHIND4_0080 | 86923..90492 [+], 3570 | sex pilus assembly | TraG_F, T4SS component | |
81 | ICEVCHIND4_0081 | 90525..90956 [-], 432 | EexS | ||
82 | ICEVCHIND4_0082 | 91011..91544 [-], 534 | transcriptional activator | ||
83 | ICEVCHIND4_0083 | 91541..91840 [-], 300 | SetD | ||
84 | ICEVCHIND4_0084 | 91837..92385 [-], 549 | lytic transglycosylase, catalytic | Orf169_F, T4SS component | |
85 | ICEVCHIND4_0085 | 92372..93034 [-], 663 | conserved hypothetical protein | ||
86 | ICEVCHIND4_0086 | 93021..93890 [-], 870 | conserved hypothetical protein | ||
87 | ICEVCHIND4_0087 | 93946..94197 [-], 252 | SetQ | ||
88 | ICEVCHIND4_0088 | 94315..94962 [+], 648 | HTH-type transcriptional regulator for conjugative element R391 | ||
89 | ICEVCHIND4_0089 | 95219..95326 [+], 108 | peptide termination factor |
(1) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PubMed:20041216] ![]() |
(2) Marrero J; Waldor MK (2007). The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 189(8):3302-5. [PubMed:17307849] ![]() |
![]() |
![]() |