I. Information of ICE

ICEberg ID	180
Name	ICEKpnHS11286-1
Organism	Klebsiella pneumoniae HS11286
Size (bp)	62230
GC content [Genome] (%)	52.45[57.48]
Insertion site	tRNA-Asn34 (KPHS_34600)
Function	-
Species that ICE can be transferred to	-
Nucleotide Sequence	CP003200 (complete ICE sequence in this genome)
Replicon	chromosome (5333942 bp, BioProject:78789) [CP003200]
Genome coordinates	3433546..3495775
Putative oriT region	coordinates: 3479689..3479812;   oriTDB id:  200012 CCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGC TAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
Putative relaxase	-

II. ICE interaction with IME/CIME/

The interaction information of ICEKpnHS11286-1 is not available.

The graph information of ICEKpnHS11286-1 components from CP003200
Complete gene list of ICEKpnHS11286-1 from CP003200
#	Gene	Coordinates [+/-], size (bp)	Product  (GenBank annotation)	*Reannotation
1	KPHS_34560	3428850..3429770 [+], 921	LysR family transcriptional regulator
2	KPHS_34570	3430155..3431096 [-], 942	hypothetical protein
3	KPHS_34580	3431175..3432125 [-], 951	transcriptional regulator Cbl
4	KPHS_34590	3432232..3433149 [-], 918	nitrogen assimilation transcriptional regulator
5	KPHS_34600	3433717..3434979 [+], 1263	integrase	Integrase
6	KPHS_34610	3435173..3436477 [-], 1305	salicylate synthase Irp9
7	KPHS_34620	3436505..3437785 [-], 1281	MFS superfamily transporter signal transducer
8	KPHS_34630	3437778..3439580 [-], 1803	permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtQ
9	KPHS_34640	3439567..3441279 [-], 1713	lipoprotein inner membrane ABC-transporter
10	KPHS_34650	3441536..3442495 [+], 960	AraC-type transcriptional regulator
11	KPHS_34660	3442686..3448793 [+], 6108	High-molecular-weight nonribosomal peptide/polyketide synthetase 2 (HMWP2)
12	KPHS_34670	3448881..3458372 [+], 9492	High-molecular-weight nonribosomal peptide/polyketide synthetase 1 (HMWP1)
13	KPHS_34680	3458369..3459469 [+], 1101	irp3 protein, yersiniabactin siderophore biosynthetic protein
14	KPHS_34690	3459532..3460269 [+], 738	putative thioesterase YbtT
15	KPHS_34700	3460273..3461850 [+], 1578	yersiniabactin siderophore biosynthetic protein
16	KPHS_34710	3461981..3464002 [+], 2022	pesticin/yersiniabactin TonB-dependent receptor
17	KPHS_34720	3464874..3465800 [+], 927	hypothetical protein
18	KPHS_34730	3466314..3466895 [+], 582	hypothetical protein
19	KPHS_34740	3467337..3467465 [+], 129	hypothetical protein
20	KPHS_34750	3468034..3468267 [+], 234	hypothetical protein
21	KPHS_34760	3468340..3469050 [+], 711	putative type IV secretory pathway VirB1 component	VirB1, T4SS component
22	KPHS_34770	3469164..3469343 [+], 180	hypothetical protein	VirB2, T4SS component
23	KPHS_34780	3469356..3472094 [+], 2739	putative type IV secretory pathway VirB4 component	VirB4, T4SS component
24	KPHS_34790	3472112..3472819 [+], 708	hypothetical protein	VirB5, T4SS component
25	KPHS_34800	3473073..3474146 [+], 1074	hypothetical protein	VirB6, T4SS component
26	KPHS_34810	3474219..3474338 [-], 120	hypothetical protein
27	KPHS_34820	3474368..3475051 [+], 684	type IV secretion system VirB8 component	VirB8, T4SS component
28	KPHS_34830	3475048..3475956 [+], 909	type IV secretory pathway VirB9 component	VirB9, T4SS component
29	KPHS_34840	3476000..3477250 [+], 1251	type IV secretory pathway VirB10 component	VirB10, T4SS component
30	KPHS_34850	3477240..3478265 [+], 1026	type IV secretory pathway VirB11 component	VirB11, T4SS component
31	KPHS_34860	3479193..3479348 [+], 156	hypothetical protein
32	KPHS_34870	3480058..3481917 [+], 1860	putative MobB mobilization protein	VirD4, T4SS component
33	KPHS_34880	3481927..3482673 [+], 747	putative MobC mobilization protein
34	KPHS_34890	3482866..3483810 [-], 945	putative Antirestriction protein ardC
35	KPHS_34900	3484816..3485811 [+], 996	hypothetical protein
36	KPHS_34910	3485808..3486896 [+], 1089	hypothetical protein
37	KPHS_34920	3487133..3487387 [+], 255	hypothetical protein
38	KPHS_34930	3487384..3489264 [+], 1881	hypothetical protein
39	KPHS_34940	3489548..3490567 [-], 1020	hypothetical protein
40	KPHS_34950	3491966..3494212 [+], 2247	hypothetical protein
41	KPHS_34960	3494327..3495427 [+], 1101	putative Retron-type reverse transcriptase
42	KPHS_34970	3495637..3495780 [-], 144	hypothetical protein
43	KPHS_34980	3495799..3497433 [-], 1635	putative sodium:hydrogen antiporter
44	KPHS_34990	3498025..3498849 [+], 825	putative regulatory protein TetR
45	KPHS_35000	3498899..3499702 [+], 804	putative dehydrogenase
46	KPHS_35010	3499777..3499920 [-], 144	hypothetical protein

Flanking regions