I. Information of ICE

ICEberg ID	132
Name	ICEEcoUMN026-1
Organism	Escherichia coli UMN026
Size (bp)	65732
GC content [Genome] (%)	52.01[50.72]
Insertion site	tRNA-asn(ECUMN_tRNA17)
Function	Yersiniabactin synthesis
Species that ICE can be transferred to	-
Nucleotide Sequence	CU928163 (complete ICE sequence in this genome)
Replicon	chromosome (5202090 bp, BioProject:33415) [NC_011751]
Genome coordinates	2277431..2343162
Putative oriT region	coordinates: 2324782..2324905;   oriTDB id:  200012 CCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGC TAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
Putative relaxase	-

II. ICE interaction with IME/CIME/

The interaction information of ICEEcoUMN026-1 is not available.

The graph information of ICEEcoUMN026-1 components from CU928163
Complete gene list of ICEEcoUMN026-1 from CU928163
#	Gene	Coordinates [+/-], size (bp)	Product  (GenBank annotation)	*Reannotation
1	yedX	2272534..2272947 [+], 414	conserved hypothetical protein
2	yedY	2273056..2274060 [+], 1005	exported heme-molybdoenzyme molybdopterin-containing subunit YedY; TAT export
3	yedZ	2274061..2274696 [+], 636	heme-molybdoenzyme heme-containing subunit YedZ; cytochrome b subunit
4	yodA	2274953..2275603 [+], 651	conserved hypothetical protein; putative metal-binding protein
5	yeeI	2276457..2277254 [+], 798	conserved hypothetical protein
6	int	2277592..2278854 [+], 1263	integrase	Integrase
7	irp	2279048..2280352 [-], 1305	Salicylate synthase
8	irp	2280380..2281783 [-], 1404	putative permease of yersiniabactin-iron transporter YbtX
9	irp	2281653..2283482 [-], 1830	permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtQ
10	irp	2283442..2285244 [-], 1803	permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtP
11	ybtA	2285411..2286370 [+], 960	AraC type regulator of yersiniabactin gene cluster (HPI)
12	irp	2286543..2292668 [+], 6126	High-molecular-weight nonribosomal peptide/polyketide synthetase 2 (HMWP2)
13	irp	2292756..2302247 [+], 9492	High-molecular-weight nonribosomal peptide/polyketide synthetase 1 (HMWP1)
14	irp	2302184..2303344 [+], 1161	Thiazolinyl-S-HMWP1 reductase YbtU
15	irp	2303341..2304144 [+], 804	putative thioesterase YbtT
16	irp	2304148..2305725 [+], 1578	salicyl-AMP ligase YbtE
17	fyuA	2305856..2307877 [+], 2022	Yersiniabactin/pesticin outer membrane receptor (IRPC)
18	ECUMN_2279	2308691..2309674 [+], 984	conserved hypothetical protein
19	ECUMN_2280	2310018..2310203 [+], 186	conserved hypothetical protein
20	ECUMN_2281	2310188..2310769 [+], 582	conserved hypothetical protein
21	ECUMN_2282	2310759..2310968 [+], 210	putative lambdoid prophage protein from the DksA/TraR family with a zinc finger
22	ECUMN_2283	2311211..2311339 [+], 129	conserved hypothetical protein
23	ECUMN_2284	2312196..2312924 [+], 729	putative type IV secretory pathway VirB1 component	VirB1, T4SS component
24	ECUMN_2285	2312924..2313217 [+], 294	putative type IV secretory pathway VirB2 component	VirB2, T4SS component
25	ECUMN_2286	2313230..2315968 [+], 2739	putative type IV secretory pathway VirB4 component	VirB4, T4SS component
26	ECUMN_2287	2315987..2316700 [+], 714	putative type IV secretory pathway VirB5 component	VirB5, T4SS component
27	ECUMN_2288	2316708..2316950 [+], 243	conserved hypothetical protein; putative exported protein	MagB05, T4SS component
28	ECUMN_2289	2316954..2317298 [+], 345	Type IV secretory pathway VirB6 component (fragment)	VirB6, T4SS component
29	insH	2317336..2318352 [-], 1017	IS5 transposase and trans-activator; CP4-44 prophage
30	ECUMN_2291	2318315..2319226 [+], 912	Type IV secretory pathway VirB6 component (fragment)	VirB6, T4SS component
31	ECUMN_2292	2319444..2320127 [+], 684	putative type IV secretory pathway VirB8 component	VirB8, T4SS component
32	ECUMN_2293	2320124..2321032 [+], 909	putative type IV secretory pathway VirB9 component	VirB9, T4SS component
33	ECUMN_2294	2321070..2322338 [+], 1269	putative type IV secretory pathway VirB10 component	VirB10, T4SS component
34	ECUMN_2295	2322328..2323353 [+], 1026	putative type IV secretory pathway VirB11 component	VirB11, T4SS component
35	ECUMN_2296	2323520..2323753 [+], 234	conserved hypothetical protein (partial)
36	ECUMN_2297	2323789..2324091 [+], 303	kikA from plasmid origin; putative exported protein
37	ECUMN_2298	2324136..2324441 [+], 306	conserved hypothetical protein
38	ECUMN_2299	2325151..2327010 [+], 1860	putative MobB mobilization protein	VirD4, T4SS component
39	ECUMN_2300	2327014..2327766 [+], 753	putative MobC mobilization protein
40	ECUMN_2301	2327959..2329098 [-], 1140	putative Antirestriction protein ardC
41	ECUMN_2302	2329140..2329373 [+], 234	hypothetical protein
42	ECUMN_2303	2329496..2329807 [+], 312	hypothetical protein
43	ECUMN_2304	2329909..2330904 [+], 996	conserved hypothetical protein; putative Restriction endonuclease; putqtive coiled-coil
44	ECUMN_2305	2330901..2331989 [+], 1089	conserved hypothetical protein
45	ECUMN_2306	2331974..2332480 [+], 507	conserved hypothetical protein
46	ECUMN_2307	2332477..2334357 [+], 1881	conserved hypothetical protein; putative ATPase involved in DNA repair; putative coiled-coil protein
47	ECUMN_2308	2334641..2335660 [-], 1020	conserved hypothetical protein
48	ECUMN_2309	2335692..2335829 [-], 138	hypothetical protein
49	ECUMN_2310	2337029..2339305 [+], 2277	conserved hypothetical protein
50	ECUMN_2312	2339420..2340520 [+], 1101	putative Retron-type reverse transcriptase
51	ECUMN_2313	2341176..2341670 [-], 495	hypothetical protein
52	ECUMN_2314	2342042..2342320 [-], 279	hypothetical protein
53	ECUMN_2315	2342428..2342571 [-], 144	hypothetical protein
54	ECUMN_2316	2342466..2342945 [-], 480	conserved hypothetical protein, putative transposase