![]() | 132 |
![]() ![]() | ICEEcoUMN026-1 ![]() |
![]() | Escherichia coli UMN026 |
![]() | 65732 |
![]() | 52.01[50.72] |
![]() | tRNA-asn(ECUMN_tRNA17) |
![]() | Yersiniabactin synthesis |
![]() | - |
![]() | CU928163 (complete ICE sequence in this genome) |
![]() | chromosome (5202090 bp, BioProject:33415) [NC_011751] |
![]() | 2277431..2343162 |
![]() ![]() | coordinates: 2324782..2324905; oriTDB id: 200012 CCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGC TAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC |
![]() ![]() | - |
The graph information of ICEEcoUMN026-1 components from CU928163 | |||||
![]() | |||||
Complete gene list of ICEEcoUMN026-1 from CU928163 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | yedX | 2272534..2272947 [+], 414 | conserved hypothetical protein | ||
2 | yedY | 2273056..2274060 [+], 1005 | exported heme-molybdoenzyme molybdopterin-containing subunit YedY; TAT export | ||
3 | yedZ | 2274061..2274696 [+], 636 | heme-molybdoenzyme heme-containing subunit YedZ; cytochrome b subunit | ||
4 | yodA | 2274953..2275603 [+], 651 | conserved hypothetical protein; putative metal-binding protein | ||
5 | yeeI | 2276457..2277254 [+], 798 | conserved hypothetical protein | ||
6 | int | 2277592..2278854 [+], 1263 | integrase | Integrase | |
7 | irp | 2279048..2280352 [-], 1305 | Salicylate synthase | ||
8 | irp | 2280380..2281783 [-], 1404 | putative permease of yersiniabactin-iron transporter YbtX | ||
9 | irp | 2281653..2283482 [-], 1830 | permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtQ | ||
10 | irp | 2283442..2285244 [-], 1803 | permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtP | ||
11 | ybtA | 2285411..2286370 [+], 960 | AraC type regulator of yersiniabactin gene cluster (HPI) | ||
12 | irp | 2286543..2292668 [+], 6126 | High-molecular-weight nonribosomal peptide/polyketide synthetase 2 (HMWP2) | ||
13 | irp | 2292756..2302247 [+], 9492 | High-molecular-weight nonribosomal peptide/polyketide synthetase 1 (HMWP1) | ||
14 | irp | 2302184..2303344 [+], 1161 | Thiazolinyl-S-HMWP1 reductase YbtU | ||
15 | irp | 2303341..2304144 [+], 804 | putative thioesterase YbtT | ||
16 | irp | 2304148..2305725 [+], 1578 | salicyl-AMP ligase YbtE | ||
17 | fyuA | 2305856..2307877 [+], 2022 | Yersiniabactin/pesticin outer membrane receptor (IRPC) | ||
18 | ECUMN_2279 | 2308691..2309674 [+], 984 | conserved hypothetical protein | ||
19 | ECUMN_2280 | 2310018..2310203 [+], 186 | conserved hypothetical protein | ||
20 | ECUMN_2281 | 2310188..2310769 [+], 582 | conserved hypothetical protein | ||
21 | ECUMN_2282 | 2310759..2310968 [+], 210 | putative lambdoid prophage protein from the DksA/TraR family with a zinc finger | ||
22 | ECUMN_2283 | 2311211..2311339 [+], 129 | conserved hypothetical protein | ||
23 | ECUMN_2284 | 2312196..2312924 [+], 729 | putative type IV secretory pathway VirB1 component | VirB1, T4SS component | |
24 | ECUMN_2285 | 2312924..2313217 [+], 294 | putative type IV secretory pathway VirB2 component | VirB2, T4SS component | |
25 | ECUMN_2286 | 2313230..2315968 [+], 2739 | putative type IV secretory pathway VirB4 component | VirB4, T4SS component | |
26 | ECUMN_2287 | 2315987..2316700 [+], 714 | putative type IV secretory pathway VirB5 component | VirB5, T4SS component | |
27 | ECUMN_2288 | 2316708..2316950 [+], 243 | conserved hypothetical protein; putative exported protein | MagB05, T4SS component | |
28 | ECUMN_2289 | 2316954..2317298 [+], 345 | Type IV secretory pathway VirB6 component (fragment) | VirB6, T4SS component | |
29 | insH | 2317336..2318352 [-], 1017 | IS5 transposase and trans-activator; CP4-44 prophage | ||
30 | ECUMN_2291 | 2318315..2319226 [+], 912 | Type IV secretory pathway VirB6 component (fragment) | VirB6, T4SS component | |
31 | ECUMN_2292 | 2319444..2320127 [+], 684 | putative type IV secretory pathway VirB8 component | VirB8, T4SS component | |
32 | ECUMN_2293 | 2320124..2321032 [+], 909 | putative type IV secretory pathway VirB9 component | VirB9, T4SS component | |
33 | ECUMN_2294 | 2321070..2322338 [+], 1269 | putative type IV secretory pathway VirB10 component | VirB10, T4SS component | |
34 | ECUMN_2295 | 2322328..2323353 [+], 1026 | putative type IV secretory pathway VirB11 component | VirB11, T4SS component | |
35 | ECUMN_2296 | 2323520..2323753 [+], 234 | conserved hypothetical protein (partial) | ||
36 | ECUMN_2297 | 2323789..2324091 [+], 303 | kikA from plasmid origin; putative exported protein | ||
37 | ECUMN_2298 | 2324136..2324441 [+], 306 | conserved hypothetical protein | ||
38 | ECUMN_2299 | 2325151..2327010 [+], 1860 | putative MobB mobilization protein | VirD4, T4SS component | |
39 | ECUMN_2300 | 2327014..2327766 [+], 753 | putative MobC mobilization protein | ||
40 | ECUMN_2301 | 2327959..2329098 [-], 1140 | putative Antirestriction protein ardC | ||
41 | ECUMN_2302 | 2329140..2329373 [+], 234 | hypothetical protein | ||
42 | ECUMN_2303 | 2329496..2329807 [+], 312 | hypothetical protein | ||
43 | ECUMN_2304 | 2329909..2330904 [+], 996 | conserved hypothetical protein; putative Restriction endonuclease; putqtive coiled-coil | ||
44 | ECUMN_2305 | 2330901..2331989 [+], 1089 | conserved hypothetical protein | ||
45 | ECUMN_2306 | 2331974..2332480 [+], 507 | conserved hypothetical protein | ||
46 | ECUMN_2307 | 2332477..2334357 [+], 1881 | conserved hypothetical protein; putative ATPase involved in DNA repair; putative coiled-coil protein | ||
47 | ECUMN_2308 | 2334641..2335660 [-], 1020 | conserved hypothetical protein | ||
48 | ECUMN_2309 | 2335692..2335829 [-], 138 | hypothetical protein | ||
49 | ECUMN_2310 | 2337029..2339305 [+], 2277 | conserved hypothetical protein | ||
50 | ECUMN_2312 | 2339420..2340520 [+], 1101 | putative Retron-type reverse transcriptase | ||
51 | ECUMN_2313 | 2341176..2341670 [-], 495 | hypothetical protein | ||
52 | ECUMN_2314 | 2342042..2342320 [-], 279 | hypothetical protein | ||
53 | ECUMN_2315 | 2342428..2342571 [-], 144 | hypothetical protein | ||
54 | ECUMN_2316 | 2342466..2342945 [-], 480 | conserved hypothetical protein, putative transposase |
Identified as part of this study from CU928163 |