ICEberg
I. Information of ICE
ICEberg ID132
Name ICEEcoUMN026-1 This is a putative ICE identified in this study by Blast
OrganismEscherichia coli UMN026
Size (bp)65732
GC content [Genome] (%)52.01[50.72]
Insertion sitetRNA-asn(ECUMN_tRNA17)
FunctionYersiniabactin synthesis
Species that ICE can be transferred to-
Nucleotide SequenceCU928163 (complete ICE sequence in this genome)
Replicon chromosome (5202090 bp, BioProject:33415) [NC_011751]
Genome coordinates2277431..2343162 
Putative oriT region coordinates: 2324782..2324905;   oriTDB id:  200012
CCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGC
TAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICEEcoUMN026-1 is not available.



The graph information of ICEEcoUMN026-1 components from CU928163
Complete gene list of ICEEcoUMN026-1 from CU928163
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1yedX2272534..2272947 [+], 414conserved hypothetical protein
2yedY2273056..2274060 [+], 1005exported heme-molybdoenzyme molybdopterin-containing subunit YedY; TAT export
3yedZ2274061..2274696 [+], 636heme-molybdoenzyme heme-containing subunit YedZ; cytochrome b subunit
4yodA2274953..2275603 [+], 651conserved hypothetical protein; putative metal-binding protein
5yeeI2276457..2277254 [+], 798conserved hypothetical protein
6int2277592..2278854 [+], 1263integraseIntegrase 
7irp2279048..2280352 [-], 1305Salicylate synthase
8irp2280380..2281783 [-], 1404putative permease of yersiniabactin-iron transporter YbtX
9irp2281653..2283482 [-], 1830permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtQ
10irp2283442..2285244 [-], 1803permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtP
11ybtA2285411..2286370 [+], 960AraC type regulator of yersiniabactin gene cluster (HPI)
12irp2286543..2292668 [+], 6126High-molecular-weight nonribosomal peptide/polyketide synthetase 2 (HMWP2)
13irp2292756..2302247 [+], 9492High-molecular-weight nonribosomal peptide/polyketide synthetase 1 (HMWP1)
14irp2302184..2303344 [+], 1161Thiazolinyl-S-HMWP1 reductase YbtU
15irp2303341..2304144 [+], 804putative thioesterase YbtT
16irp2304148..2305725 [+], 1578salicyl-AMP ligase YbtE
17fyuA2305856..2307877 [+], 2022Yersiniabactin/pesticin outer membrane receptor (IRPC)
18ECUMN_22792308691..2309674 [+], 984conserved hypothetical protein
19ECUMN_22802310018..2310203 [+], 186conserved hypothetical protein
20ECUMN_22812310188..2310769 [+], 582conserved hypothetical protein
21ECUMN_22822310759..2310968 [+], 210putative lambdoid prophage protein from the DksA/TraR family with a zinc finger
22ECUMN_22832311211..2311339 [+], 129conserved hypothetical protein
23ECUMN_22842312196..2312924 [+], 729putative type IV secretory pathway VirB1 componentVirB1, T4SS component 
24ECUMN_22852312924..2313217 [+], 294putative type IV secretory pathway VirB2 componentVirB2, T4SS component 
25ECUMN_22862313230..2315968 [+], 2739putative type IV secretory pathway VirB4 componentVirB4, T4SS component 
26ECUMN_22872315987..2316700 [+], 714putative type IV secretory pathway VirB5 componentVirB5, T4SS component 
27ECUMN_22882316708..2316950 [+], 243conserved hypothetical protein; putative exported proteinMagB05, T4SS component 
28ECUMN_22892316954..2317298 [+], 345Type IV secretory pathway VirB6 component (fragment)VirB6, T4SS component 
29insH2317336..2318352 [-], 1017IS5 transposase and trans-activator; CP4-44 prophage
30ECUMN_22912318315..2319226 [+], 912Type IV secretory pathway VirB6 component (fragment)VirB6, T4SS component 
31ECUMN_22922319444..2320127 [+], 684putative type IV secretory pathway VirB8 componentVirB8, T4SS component 
32ECUMN_22932320124..2321032 [+], 909putative type IV secretory pathway VirB9 componentVirB9, T4SS component 
33ECUMN_22942321070..2322338 [+], 1269putative type IV secretory pathway VirB10 componentVirB10, T4SS component 
34ECUMN_22952322328..2323353 [+], 1026putative type IV secretory pathway VirB11 componentVirB11, T4SS component 
35ECUMN_22962323520..2323753 [+], 234conserved hypothetical protein (partial)
36ECUMN_22972323789..2324091 [+], 303kikA from plasmid origin; putative exported protein
37ECUMN_22982324136..2324441 [+], 306conserved hypothetical protein
38ECUMN_22992325151..2327010 [+], 1860putative MobB mobilization proteinVirD4, T4SS component 
39ECUMN_23002327014..2327766 [+], 753putative MobC mobilization protein
40ECUMN_23012327959..2329098 [-], 1140putative Antirestriction protein ardC
41ECUMN_23022329140..2329373 [+], 234hypothetical protein
42ECUMN_23032329496..2329807 [+], 312hypothetical protein
43ECUMN_23042329909..2330904 [+], 996conserved hypothetical protein; putative Restriction endonuclease; putqtive coiled-coil
44ECUMN_23052330901..2331989 [+], 1089conserved hypothetical protein
45ECUMN_23062331974..2332480 [+], 507conserved hypothetical protein
46ECUMN_23072332477..2334357 [+], 1881conserved hypothetical protein; putative ATPase involved in DNA repair; putative coiled-coil protein
47ECUMN_23082334641..2335660 [-], 1020conserved hypothetical protein
48ECUMN_23092335692..2335829 [-], 138hypothetical protein
49ECUMN_23102337029..2339305 [+], 2277conserved hypothetical protein
50ECUMN_23122339420..2340520 [+], 1101putative Retron-type reverse transcriptase
51ECUMN_23132341176..2341670 [-], 495hypothetical protein
52ECUMN_23142342042..2342320 [-], 279hypothetical protein
53ECUMN_23152342428..2342571 [-], 144hypothetical protein
54ECUMN_23162342466..2342945 [-], 480conserved hypothetical protein, putative transposase
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins48Fasta
Identified as part of this study from CU928163

Genomics & Bioinformatics Group in MML, SJTU