ICEberg ID | 130 |
Name | ICECkoBAA-1 |
Organism | Citrobacter koseri ATCC BAA-895 |
Size (bp) | 103383 |
GC content [Genome] (%) | 53.68[53.83] |
Insertion site | ccagtcagaggag(conserved seq. of the tRNA-asn 3'-end) |
Function | Salicylate synthesis |
Species that ICE can be transferred to | - |
Nucleotide Sequence | CP000822 (complete ICE sequence in this genome) |
Replicon | chromosome (4720462 bp, BioProject:12716) [NC_009792] |
Genome coordinates | 816173..919555 |
Putative oriT region | coordinates: 872969..873092; oriTDB id: 200012 GGCGGCACACCGTCGCGCGCTACGCGCGACCAACCCCTTTAAGACGCGCGTTTAGCCTATTTTTTCTTCG CAAGCTCGAAAAAATGGGAACGCTGCTTTAAAGGGGTTGGTCGCGCCTAATCGG |
Putative relaxase | - |
The graph information of ICECkoBAA-1 components from CP000822 | |||||
Complete gene list of ICECkoBAA-1 from CP000822 | |||||
# | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
1 | CKO_00849 | 811698..813014 [-], 1317 | hypothetical protein | ||
2 | CKO_00850 | 813243..814076 [+], 834 | hypothetical protein | ||
3 | CKO_00851 | 814069..815052 [+], 984 | hypothetical protein | ||
4 | CKO_00852 | 815049..816059 [+], 1011 | hypothetical protein | ||
5 | CKO_00853 | 816421..816819 [+], 399 | hypothetical protein | ||
6 | CKO_00855 | 817127..817606 [-], 480 | hypothetical protein | ||
7 | CKO_00854 | 817382..817714 [+], 333 | hypothetical protein | ||
8 | CKO_00856 | 817711..817977 [-], 267 | hypothetical protein | ||
9 | CKO_00857 | 818123..818857 [-], 735 | hypothetical protein | ||
10 | CKO_00858 | 818858..819082 [-], 225 | hypothetical protein | ||
11 | CKO_00859 | 819506..829132 [+], 9627 | hypothetical protein | ||
12 | CKO_00861 | 829028..829201 [-], 174 | hypothetical protein | ||
13 | CKO_00860 | 829164..831773 [+], 2610 | hypothetical protein | ||
14 | CKO_00862 | 831783..832652 [+], 870 | hypothetical protein | ||
15 | CKO_00863 | 832676..832930 [+], 255 | hypothetical protein | ||
16 | CKO_00865 | 832793..832993 [-], 201 | hypothetical protein | ||
17 | CKO_00864 | 832934..834064 [+], 1131 | hypothetical protein | ||
18 | CKO_00866 | 834061..835329 [+], 1269 | hypothetical protein | ||
19 | CKO_00867 | 835377..840173 [+], 4797 | hypothetical protein | ||
20 | CKO_00868 | 840223..843255 [+], 3033 | hypothetical protein | ||
21 | CKO_00869 | 843299..849799 [+], 6501 | hypothetical protein | ||
22 | CKO_00870 | 849741..856274 [+], 6534 | hypothetical protein | ||
23 | CKO_00871 | 856267..857730 [+], 1464 | hypothetical protein | ||
24 | CKO_00872 | 857792..859231 [+], 1440 | hypothetical protein | ||
25 | CKO_00873 | 859228..863595 [+], 4368 | hypothetical protein | ||
26 | CKO_00874 | 863626..866085 [+], 2460 | hypothetical protein | ||
27 | CKO_00875 | 866152..867612 [+], 1461 | hypothetical protein | ||
28 | CKO_00876 | 867758..868327 [+], 570 | hypothetical protein | ||
29 | CKO_00877 | 868362..868874 [+], 513 | hypothetical protein | ||
30 | CKO_00878 | 869101..869256 [+], 156 | hypothetical protein | ||
31 | CKO_00879 | 870144..870908 [-], 765 | hypothetical protein | ||
32 | CKO_00880 | 870917..872671 [-], 1755 | hypothetical protein | VirD4, T4SS component | |
33 | CKO_00881 | 872747..873001 [-], 255 | hypothetical protein | ||
34 | CKO_00882 | 873294..873581 [+], 288 | hypothetical protein | ||
35 | CKO_00883 | 873434..873739 [-], 306 | hypothetical protein | ||
36 | CKO_00884 | 873782..874150 [-], 369 | hypothetical protein | MagB14, T4SS component | |
37 | CKO_00885 | 874117..874515 [-], 399 | hypothetical protein | ||
38 | CKO_00886 | 874512..875537 [-], 1026 | hypothetical protein | VirB11, T4SS component | |
39 | CKO_00888 | 875527..875847 [-], 321 | hypothetical protein | ||
40 | CKO_00887 | 875696..875869 [+], 174 | hypothetical protein | ||
41 | CKO_00889 | 875859..877103 [-], 1245 | hypothetical protein | VirB10, T4SS component | |
42 | CKO_00890 | 877147..878055 [-], 909 | hypothetical protein | VirB9, T4SS component | |
43 | CKO_00891 | 878052..878735 [-], 684 | hypothetical protein | VirB8, T4SS component | |
44 | CKO_00892 | 878728..878880 [-], 153 | hypothetical protein | VirB7, T4SS component | |
45 | CKO_00893 | 878957..880030 [-], 1074 | hypothetical protein | VirB6, T4SS component | |
46 | CKO_00894 | 880034..880276 [-], 243 | hypothetical protein | MagB05, T4SS component | |
47 | CKO_00895 | 880284..880991 [-], 708 | hypothetical protein | VirB5, T4SS component | |
48 | CKO_00896 | 881009..883747 [-], 2739 | hypothetical protein | VirB4, T4SS component | |
49 | CKO_00897 | 883760..884053 [-], 294 | hypothetical protein | VirB2, T4SS component | |
50 | CKO_00898 | 884053..884763 [-], 711 | hypothetical protein | VirB1, T4SS component | |
51 | CKO_00899 | 884836..885069 [-], 234 | hypothetical protein | ||
52 | CKO_00900 | 885330..885470 [+], 141 | hypothetical protein | ||
53 | CKO_00901 | 885638..885766 [-], 129 | hypothetical protein | ||
54 | CKO_00902 | 886208..886789 [-], 582 | hypothetical protein | ||
55 | CKO_00903 | 886978..887163 [-], 186 | hypothetical protein | ||
56 | CKO_00904 | 887303..888229 [-], 927 | hypothetical protein | ||
57 | CKO_00905 | 889101..891122 [-], 2022 | hypothetical protein | ||
58 | CKO_00906 | 891253..892830 [-], 1578 | hypothetical protein | ||
59 | CKO_00907 | 892834..893622 [-], 789 | hypothetical protein | ||
60 | CKO_00908 | 893634..894734 [-], 1101 | hypothetical protein | ||
61 | CKO_00909 | 894731..904222 [-], 9492 | hypothetical protein | ||
62 | CKO_00910 | 904310..904987 [-], 678 | hypothetical protein | ||
63 | CKO_00911 | 904911..910421 [-], 5511 | hypothetical protein | ||
64 | CKO_00912 | 910612..911571 [-], 960 | hypothetical protein | ||
65 | CKO_00913 | 911828..913540 [+], 1713 | hypothetical protein | ||
66 | CKO_00914 | 913527..915329 [+], 1803 | hypothetical protein | ||
67 | CKO_00915 | 915322..916602 [+], 1281 | hypothetical protein | ||
68 | CKO_00916 | 916630..917934 [+], 1305 | hypothetical protein | ||
69 | CKO_00917 | 918128..919390 [-], 1263 | hypothetical protein | Integrase | |
70 | CKO_00918 | 919780..919872 [-], 93 | hypothetical protein | ||
71 | CKO_00920 | 919791..920003 [-], 213 | hypothetical protein | ||
72 | CKO_00919 | 919903..920859 [+], 957 | hypothetical protein | ||
73 | CKO_00921 | 920970..921878 [+], 909 | hypothetical protein | ||
74 | CKO_00922 | 922084..922587 [-], 504 | hypothetical protein | ||
75 | CKO_00923 | 922699..922938 [+], 240 | hypothetical protein | ||
76 | CKO_00924 | 923020..923118 [+], 99 | hypothetical protein | ||
77 | CKO_00925 | 923155..924378 [+], 1224 | hypothetical protein |
Flanking regions |
Identified as part of this study from CP000822 |