I. Information of ICE

ICEberg ID	129
Name	ICEEcoED1a-1
Organism	Escherichia coli ED1a
Size (bp)	58182
GC content [Genome] (%)	53.13[50.73]
Insertion site	tRNA-asn(ECED1_tRNA22)
Function	Yersiniabactin synthesis
Species that ICE can be transferred to	-
Nucleotide Sequence	CU928162 (complete ICE sequence in this genome)
Replicon	chromosome (5209548 bp, BioProject:33409) [NC_011745]
Genome coordinates	2164157..2222338
Putative oriT region	coordinates: 2210273..2210396;   oriTDB id:  200012 CCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGC TAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
Putative relaxase	-

II. ICE interaction with IME/CIME/

The interaction information of ICEEcoED1a-1 is not available.

The graph information of ICEEcoED1a-1 components from CU928162
Complete gene list of ICEEcoED1a-1 from CU928162
#	Gene	Coordinates [+/-], size (bp)	Product  (GenBank annotation)	*Reannotation
1	yedZ	2160015..2160650 [+], 636	heme-molybdoenzyme heme-containing subunit YedZ; cytochrome b subunit
2	yodA	2160907..2161557 [+], 651	conserved hypothetical protein; putative metal-binding protein
3	ECED1_2239	2161667..2161816 [+], 150	conserved hypothetical protein
4	yodB	2161900..2162430 [+], 531	putative cytochrome
5	yeeI	2163183..2163980 [+], 798	conserved hypothetical protein
6	int	2164318..2165580 [+], 1263	integrase	Integrase
7	irp	2165774..2167078 [-], 1305	Salicylate synthase
8	irp	2167106..2168509 [-], 1404	putative permease of yersiniabactin-iron transporter YbtX
9	irp	2168379..2170208 [-], 1830	permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtQ
10	irp	2170168..2171970 [-], 1803	permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtP
11	ybtA	2172137..2173096 [+], 960	AraC type regulator of yersiniabactin gene cluster (HPI)
12	irp	2173269..2179394 [+], 6126	High-molecular-weight nonribosomal peptide/polyketide synthetase 2 (HMWP2)
13	irp	2179482..2188973 [+], 9492	High-molecular-weight nonribosomal peptide/polyketide synthetase 1 (HMWP1)
14	irp	2188910..2190070 [+], 1161	Thiazolinyl-S-HMWP1 reductase YbtU
15	irp	2190067..2190870 [+], 804	putative thioesterase YbtT
16	irp	2190874..2192451 [+], 1578	salicyl-AMP ligase YbtE
17	fyuA	2192582..2194603 [+], 2022	Yersiniabactin/pesticin outer membrane receptor (IRPC)
18	ECED1_2255	2195417..2196400 [+], 984	conserved hypothetical protein
19	ECED1_2256	2196744..2196929 [+], 186	conserved hypothetical protein
20	ECED1_2257	2196914..2197495 [+], 582	conserved hypothetical protein
21	ECED1_2258	2197485..2197694 [+], 210	putative lambdoid prophage protein from the DksA/TraR family with a zinc finger
22	ECED1_2259	2197937..2198065 [+], 129	conserved hypothetical protein
23	ECED1_2260	2198634..2198867 [+], 234	conserved hypothetical protein
24	ECED1_2261	2198922..2199650 [+], 729	putative type IV secretory pathway VirB1 component	VirB1, T4SS component
25	ECED1_2262	2199650..2199943 [+], 294	putative type IV secretory pathway VirB2 component	VirB2, T4SS component
26	ECED1_2263	2199956..2202694 [+], 2739	putative type IV secretory pathway VirB4 component	VirB4, T4SS component
27	ECED1_2264	2202712..2203419 [+], 708	putative type IV secretory pathway VirB5 component	VirB5, T4SS component
28	ECED1_2265	2203427..2203669 [+], 243	conserved hypothetical protein; putative exported protein	MagB05, T4SS component
29	ECED1_2266	2203673..2204746 [+], 1074	putative type IV secretory pathway VirB6 component	VirB6, T4SS component
30	ECED1_2267	2204968..2205651 [+], 684	putative type IV secretory pathway VirB8 component	VirB8, T4SS component
31	ECED1_2268	2205648..2206556 [+], 909	putative type IV secretory pathway VirB9 component	VirB9, T4SS component
32	ECED1_2269	2206586..2207842 [+], 1257	putative type IV secretory pathway VirB10 component	VirB10, T4SS component
33	ECED1_2270	2207832..2208857 [+], 1026	putative type IV secretory pathway VirB11 component	VirB11, T4SS component
34	ECED1_2271	2208854..2209252 [+], 399	conserved hypothetical protein; putative exported protein
35	kikA	2209288..2209593 [+], 306	putative plasmid conjugation protein
36	ECED1_2273	2209627..2209932 [+], 306	conserved hypothetical protein
37	ECED1_2274	2210612..2212501 [+], 1890	putative MobB mobilization protein	VirD4, T4SS component
38	ECED1_2275	2212511..2213257 [+], 747	putative MobC mobilization protein
39	ECED1_2276	2213451..2214497 [-], 1047	putative Antirestriction protein ardC
40	ECED1_2277	2215060..2215323 [-], 264	Transposase, ORF A, IS3 family, IS407 group
41	ECED1_2278	2215465..2216523 [-], 1059	conserved hypothetical protein
42	ECED1_2279	2216529..2218313 [-], 1785	conserved hypothetical protein
43	ECED1_2280	2218310..2219875 [-], 1566	putative Restriction modification system, type I similar to hsdS (fragment)
44	ECED1_2281	2219872..2221545 [-], 1674	putative HsdM; type I restriction modification enzyme methylase subunit