I. Information of ICE

ICEberg ID	128
Name	ICEDdaEch586-1
Organism	Dickeya dadantii Ech586
Size (bp)	51067
GC content [Genome] (%)	48.09[53.64]
Insertion site	tRNA-asn(Dd586_R0052)
Function	-
Species that ICE can be transferred to	-
Nucleotide Sequence	CP001836 (complete ICE sequence in this genome)
Replicon	chromosome (4818394 bp, BioProject:42519) [NC_013592]
Genome coordinates	2972027..3023093
Putative oriT region	coordinates: 3010188..3010310;   oriTDB id:  200013 CCGATCAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCGTTTTTTGGAGCTTGCGAGAAAAAACAGGCG AAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGGGCGACGGTGTGCCGCC
Putative relaxase	-

II. ICE interaction with IME/CIME/

The interaction information of ICEDdaEch586-1 is not available.

The graph information of ICEDdaEch586-1 components from CP001836
Complete gene list of ICEDdaEch586-1 from CP001836
#	Gene	Coordinates [+/-], size (bp)	Product  (GenBank annotation)	*Reannotation
1	Dd586_2633	2967367..2968440 [+], 1074	transcriptional regulator, LacI family
2	Dd586_2634	2968629..2971739 [+], 3111	glycoside hydrolase family 2 TIM barrel
3	Dd586_2635	2972189..2973460 [+], 1272	integrase family protein	Integrase
4	Dd586_2637	2973922..2974164 [-], 243	twin-arginine translocation protein, TatA/E family subunit
5	Dd586_2638	2974312..2975388 [-], 1077	conserved hypothetical protein
6	Dd586_2639	2975451..2975828 [-], 378	protein of unknown function DUF1330
7	Dd586_2640	2976019..2976912 [-], 894	transcriptional regulator, LysR family
8	Dd586_2641	2977397..2978092 [+], 696	two component transcriptional regulator, winged helix family
9	Dd586_2642	2978101..2979489 [+], 1389	multi-sensor signal transduction histidine kinase
10	Dd586_2643	2979581..2979835 [-], 255	protein of unknown function DUF1471
11	Dd586_2644	2980141..2981265 [+], 1125	dienelactone hydrolase
12	Dd586_2645	2981371..2982030 [+], 660	flavodoxin
13	Dd586_2646	2982051..2982737 [+], 687	conserved hypothetical protein
14	Dd586_2647	2982878..2983621 [-], 744	NAD(P)H dehydrogenase (quinone)
15	Dd586_2648	2983646..2984407 [-], 762	short-chain dehydrogenase/reductase SDR
16	Dd586_2649	2984611..2985753 [-], 1143	NADH:flavin oxidoreductase/NADH oxidase
17	Dd586_2650	2986038..2986676 [-], 639	flavodoxin/nitric oxide synthase
18	Dd586_2651	2986814..2987827 [-], 1014	Alcohol dehydrogenase zinc-binding domain protein
19	Dd586_2652	2988178..2989173 [+], 996	aldo/keto reductase
20	Dd586_2653	2989300..2989977 [-], 678	NAD(P)H dehydrogenase (quinone)
21	Dd586_2654	2990289..2990882 [-], 594	NAD(P)H dehydrogenase (quinone)
22	Dd586_2655	2991101..2992003 [+], 903	transcriptional regulator, AraC family
23	Dd586_2657	2992682..2993596 [+], 915	conserved hypothetical protein
24	Dd586_2658	2993749..2993943 [+], 195	phage transcriptional regulator, AlpA
25	Dd586_2659	2993958..2994542 [+], 585	conserved hypothetical protein
26	Dd586_2660	2994532..2994735 [+], 204	transcriptional regulator, TraR/DksA family
27	Dd586_2661	2994911..2995762 [-], 852	transcriptional regulator, LysR family
28	Dd586_2662	2995862..2996725 [+], 864	protein of unknown function DUF6 transmembrane
29	Dd586_2663	2997209..2997442 [+], 234	conserved hypothetical protein
30	Dd586_2664	2997519..2998226 [+], 708	Lytic transglycosylase catalytic	VirB1, T4SS component
31	Dd586_2665	2998226..2998519 [+], 294	Conjugal transfer protein TrbC	VirB2, T4SS component
32	Dd586_2666	2998530..3001274 [+], 2745	CagE, TrbE, VirB component of type IV transporter system, conserved region	VirB4, T4SS component
33	Dd586_2667	3001295..3001999 [+], 705	type IV secretion system family protein	VirB5, T4SS component
34	Dd586_2668	3002011..3002235 [+], 225	conserved hypothetical protein	MagB05, T4SS component
35	Dd586_2669	3002246..3003310 [+], 1065	TrbL/VirB6 plasmid conjugal transfer protein	VirB6, T4SS component
36	Dd586_2670	3003394..3003531 [+], 138	conserved hypothetical protein	VirB7, T4SS component
37	Dd586_2671	3003524..3004207 [+], 684	VirB8 family protein	VirB8, T4SS component
38	Dd586_2672	3004207..3005112 [+], 906	P-type conjugative transfer protein VirB9	VirB9, T4SS component
39	Dd586_2673	3005132..3006373 [+], 1242	conjugation TrbI family protein	VirB10, T4SS component
40	Dd586_2674	3006366..3006752 [+], 387	hypothetical protein
41	Dd586_2675	3006683..3007690 [-], 1008	conserved hypothetical protein
42	Dd586_2676	3007728..3008747 [+], 1020	P-type DNA transfer ATPase VirB11	VirB11, T4SS component
43	Dd586_2677	3008744..3009142 [+], 399	conserved hypothetical protein
44	Dd586_2678	3009188..3009490 [+], 303	KikA from plasmid origin; putative exported protein
45	Dd586_2679	3009540..3009845 [+], 306	conserved hypothetical protein
46	Dd586_2681	3010556..3012415 [+], 1860	putative MobB mobilization protein	VirD4, T4SS component
47	Dd586_2682	3012425..3013171 [+], 747	mobilization protein
48	Dd586_2683	3013367..3014314 [-], 948	domain of unknown function DUF1738
49	Dd586_2684	3014599..3016797 [-], 2199	helicase domain protein
50	Dd586_2685	3016841..3018469 [-], 1629	conserved hypothetical protein
51	Dd586_2686	3019385..3020161 [-], 777	short-chain dehydrogenase/reductase SDR
52	Dd586_2687	3020192..3020485 [-], 294	Stress responsive alpha-beta barrel domain protein
53	Dd586_2688	3020496..3021557 [-], 1062	Alcohol dehydrogenase zinc-binding domain protein
54	Dd586_2689	3021707..3022666 [+], 960	transcriptional regulator, LysR family
55	Dd586_2690	3023663..3024925 [+], 1263	glycosyl transferase family 28
56	Dd586_2691	3025156..3026919 [+], 1764	gamma-glutamyltransferase

Flanking regions