 ICEberg ID | 12 |
Name  | ICEVchBan5  |
| ICEO ID | ICEO_0000009 |
| Organism | Vibrio cholerae O1 Ban5 |
| Size (bp) | 102122 |
| GC content [Genome] (%) | 47.28 |
| Insertion site | prfC |
| Function | Antibiotic resistance genes: floR, strBA, sul2, dfrA1; glyoxoylase abx resistance |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | GQ463140 (complete ICE sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..102122 |
| Putative oriT region | coordinates: 5756..5862; oriTDB id: 200056 TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA |
| Putative relaxase | coordinates: 46066..48216; Locus tag: ICEVCHBAN5_0042; Family: MOBH |
The graph information of ICEVchBan5 components from GQ463140 | |||||
 | |||||
| Complete gene list of ICEVchBan5 from GQ463140 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
| 1 | ICEVCHBAN5_0001 | 415..603 [+], 189 | conserved domain protein | ||
| 2 | ICEVCHBAN5_0002 | 749..2767 [+], 2019 | putative DNA mismatch repair protein | ||
| 3 | ICEVCHBAN5_0003 | 2897..4138 [-], 1242 | integrase | Integrase | |
| 4 | ICEVCHBAN5_0004 | 4140..4313 [-], 174 | conserved hypothetical protein | ||
| 5 | ICEVCHBAN5_0005 | 4412..5386 [-], 975 | conserved hypothetical protein | ||
| 6 | ICEVCHBAN5_0006 | 5482..5649 [+], 168 | hypothetical protein | ||
| 7 | ICEVCHBAN5_0007 | 5694..5828 [+], 135 | hypothetical protein | ||
| 8 | ICEVCHBAN5_0008 | 5851..6294 [+], 444 | conserved hypothetical protein | ||
| 9 | ICEVCHBAN5_0009 | 6305..7477 [-], 1173 | protein UmuC | ||
| 10 | ICEVCHBAN5_0010 | 7761..8354 [+], 594 | transposase, IS3 family, interruption | ||
| 11 | ICEVCHBAN5_0011 | 8468..11446 [+], 2979 | transposase | ||
| 12 | ICEVCHBAN5_0012 | 11864..13357 [+], 1494 | iscr2 transposase | ||
| 13 | ICEVCHBAN5_0013 | 13388..14272 [+], 885 | conserved hypothetical protein | ||
| 14 | ICEVCHBAN5_0014 | 14489..15703 [+], 1215 | florfenicol/chloramphenicol resistance protein | ||
| 15 | ICEVCHBAN5_0015 | 15758..16036 [+], 279 | truncated helix-turn-helix multiple antibiotic resistance protein | ||
| 16 | ICEVCHBAN5_0016 | 16148..17641 [+], 1494 | iscr2 transposase | ||
| 17 | ICEVCHBAN5_0017 | 17672..18556 [+], 885 | conserved hypothetical protein | ||
| 18 | ICEVCHBAN5_0018 | 18773..19987 [+], 1215 | florfenicol/chloramphenicol resistance protein | AR | |
| 19 | ICEVCHBAN5_0019 | 20042..20320 [+], 279 | truncated helix-turn-helix multiple antibiotic resistance protein | ||
| 20 | ICEVCHBAN5_0021 | 20432..20971 [+], 540 | truncated transposase | ||
| 21 | ICEVCHBAN5_0020 | 20943..21773 [-], 831 | streptomycin resistance protein B | AR | |
| 22 | ICEVCHBAN5_0022 | 21779..22582 [-], 804 | streptomycin 3''-kinase | AR | |
| 23 | folP | 22643..23458 [-], 816 | dihydropteroate synthase | AR | |
| 24 | ICEVCHBAN5_0025 | 23929..25281 [+], 1353 | TnpA | ||
| 25 | ICEVCHBAN5_0024 | 25273..26484 [-], 1212 | transposase, Mutator family | ||
| 26 | ICEVCHBAN5_0026 | 26542..27045 [-], 504 | MutL protein | ||
| 27 | ICEVCHBAN5_0027 | 27198..27467 [-], 270 | ultraviolet light resistance protein B | ||
| 28 | ICEVCHBAN5_0028 | 27475..27924 [-], 450 | protein UmuD | ||
| 29 | ICEVCHBAN5_0029 | 28043..28180 [+], 138 | hypothetical protein | ||
| 30 | ICEVCHBAN5_0030 | 28564..29469 [+], 906 | exonuclease, RNase T and DNA polymerase III | ||
| 31 | ICEVCHBAN5_0031 | 29557..29856 [+], 300 | conserved hypothetical protein | ||
| 32 | ICEVCHBAN5_0032 | 30174..31094 [+], 921 | conserved hypothetical protein | ||
| 33 | ICEVCHBAN5_0033 | 31112..31912 [+], 801 | hypothetical protein | ||
| 34 | ICEVCHBAN5_0034 | 31896..32444 [+], 549 | conserved hypothetical protein | ||
| 35 | ICEVCHBAN5_0035 | 32457..36146 [+], 3690 | conserved hypothetical protein | ||
| 36 | ICEVCHBAN5_0036 | 36151..39891 [+], 3741 | conserved hypothetical protein | ||
| 37 | ICEVCHBAN5_0037 | 39904..42207 [+], 2304 | PglZ domain family | ||
| 38 | ICEVCHBAN5_0038 | 42246..44297 [+], 2052 | conserved hypothetical protein | ||
| 39 | ICEVCHBAN5_0039 | 44324..45094 [+], 771 | conserved hypothetical protein | ||
| 40 | ICEVCHBAN5_0041 | 45129..45944 [+], 816 | conserved hypothetical protein | ||
| 41 | ICEVCHBAN5_0040 | 45921..46043 [-], 123 | hypothetical protein | ||
| 42 | ICEVCHBAN5_0042 | 46066..48216 [+], 2151 | conjugative relaxase | Relaxase, MOBH Family | |
| 43 | ICEVCHBAN5_0043 | 48265..50085 [+], 1821 | conjugative coupling factor | TraD_F, T4SS component | |
| 44 | ICEVCHBAN5_0044 | 50095..50655 [+], 561 | conserved hypothetical protein | ||
| 45 | ICEVCHBAN5_0045 | 50642..51277 [+], 636 | putative conjugation coupling factor | ||
| 46 | ICEVCHBAN5_0046 | 51304..51891 [-], 588 | conserved hypothetical protein | ||
| 47 | traL | 52180..52461 [+], 282 | type IV conjugative transfer system protein TraL | TraL_F, T4SS component | |
| 48 | ICEVCHBAN5_0048 | 52458..53084 [+], 627 | sex pilus assembly | TraE_F, T4SS component | |
| 49 | ICEVCHBAN5_0049 | 53068..53964 [+], 897 | TraK | TraK_F, T4SS component | |
| 50 | ICEVCHBAN5_0050 | 53967..55256 [+], 1290 | sex pilus assembly | TraB_F, T4SS component | |
| 51 | ICEVCHBAN5_0051 | 55331..55903 [+], 573 | sex pilus assembly | TraV_F, T4SS component | |
| 52 | ICEVCHBAN5_0052 | 55900..56286 [+], 387 | TraA | TraA_F, T4SS component | |
| 53 | ICEVCHBAN5_0053 | 56507..57298 [+], 792 | conserved hypothetical protein | ||
| 54 | ICEVCHBAN5_0054 | 57291..58229 [+], 939 | ync | ||
| 55 | ICEVCHBAN5_0055 | 58361..59053 [+], 693 | DsbC | TrbB_I, T4SS component | |
| 56 | traC | 59053..61452 [+], 2400 | type-IV secretion system protein TraC | TraC_F, T4SS component | |
| 57 | ICEVCHBAN5_0057 | 61445..61792 [+], 348 | conserved hypothetical protein | ||
| 58 | ICEVCHBAN5_0058 | 61776..62288 [+], 513 | conjugation signal peptidase | TraF, T4SS component | |
| 59 | ICEVCHBAN5_0060 | 63407..64435 [+], 1029 | sex pilus assembly | TraU_F, T4SS component | |
| 60 | ICEVCHBAN5_0061 | 64438..68130 [+], 3693 | mating pair stabilization | TraN_F, T4SS component | |
| 61 | ICEVCHBAN5_0062 | 68221..69837 [-], 1617 | conserved hypothetical protein | ||
| 62 | ICEVCHBAN5_0063 | 69917..70672 [-], 756 | IstB domain protein ATP-binding protein | TrbB, T4SS component | |
| 63 | ICEVCHBAN5_0064 | 70662..72170 [-], 1509 | integrase, catalytic region | ||
| 64 | ICEVCHBAN5_0065 | 72269..73348 [-], 1080 | SMC domain protein | ||
| 65 | ICEVCHBAN5_0066 | 73516..74199 [-], 684 | endonuclease-1 (Endonuclease I) (Endo I) | ||
| 66 | ICEVCHBAN5_0067 | 74308..74910 [-], 603 | conserved hypothetical protein | ||
| 67 | ICEVCHBAN5_0068 | 75278..75604 [+], 327 | conserved hypothetical protein | ||
| 68 | ICEVCHBAN5_0069 | 75620..76039 [+], 420 | single-strand binding protein family | ||
| 69 | ICEVCHBAN5_0070 | 76119..76937 [+], 819 | phage recombination protein Bet | ||
| 70 | ICEVCHBAN5_0071 | 77019..77162 [+], 144 | hypothetical protein | ||
| 71 | ICEVCHBAN5_0072 | 77223..78239 [+], 1017 | YqaJ viral recombinase family | ||
| 72 | ICEVCHBAN5_0074 | 78332..79408 [+], 1077 | ATPase associated with various cellular activities, AAA_5 | ||
| 73 | ICEVCHBAN5_0073 | 78428..78550 [-], 123 | hypothetical protein | ||
| 74 | ICEVCHBAN5_0075 | 79408..80175 [+], 768 | conserved hypothetical protein | ||
| 75 | ICEVCHBAN5_0076 | 80274..81227 [+], 954 | conserved hypothetical protein | ||
| 76 | ICEVCHBAN5_0077 | 81289..81729 [+], 441 | conserved hypothetical protein | ||
| 77 | ICEVCHBAN5_0078 | 81799..83454 [+], 1656 | von Willebrand factor, type A | ||
| 78 | radC | 83539..84036 [+], 498 | DNA repair protein RadC | ||
| 79 | ICEVCHBAN5_0080 | 84036..84377 [+], 342 | conserved hypothetical protein | ||
| 80 | ICEVCHBAN5_0081 | 84468..85541 [+], 1074 | phage P4 alpha, zinc-binding domain protein | ||
| 81 | ICEVCHBAN5_0082 | 85631..86338 [+], 708 | conserved hypothetical protein | ||
| 82 | ICEVCHBAN5_0084 | 86610..87014 [+], 405 | glyoxalase/bleomycin resistance protein/dioxygenase | ||
| 83 | ICEVCHBAN5_0083 | 87011..87712 [-], 702 | conserved hypothetical protein | ||
| 84 | ICEVCHBAN5_0085 | 87812..88174 [-], 363 | conserved hypothetical protein | ||
| 85 | ICEVCHBAN5_0086 | 88245..88655 [-], 411 | membrane associated protein containing xre-family DNA-binding HTH domain | ||
| 86 | ICEVCHBAN5_0087 | 88853..89278 [-], 426 | conserved hypothetical protein | ||
| 87 | folA | 89383..89856 [-], 474 | dihydrofolate reductase | AR | |
| 88 | ICEVCHBAN5_0089 | 91074..91214 [-], 141 | hypothetical protein | ||
| 89 | ICEVCHBAN5_0091 | 91360..92304 [+], 945 | conserved hypothetical protein | TraF_F, T4SS component | |
| 90 | ICEVCHBAN5_0092 | 92307..93695 [+], 1389 | sex pilus assembly | TraH_F, T4SS component | |
| 91 | ICEVCHBAN5_0093 | 93699..97268 [+], 3570 | sex pilus assembly | TraG_F, T4SS component | |
| 92 | ICEVCHBAN5_0094 | 97301..97732 [-], 432 | EexR1 | ||
| 93 | ICEVCHBAN5_0095 | 97790..98323 [-], 534 | transcriptional activator | ||
| 94 | ICEVCHBAN5_0096 | 98320..98619 [-], 300 | SetD | ||
| 95 | ICEVCHBAN5_0097 | 98616..99164 [-], 549 | lytic transglycosylase, catalytic | Orf169_F, T4SS component | |
| 96 | ICEVCHBAN5_0098 | 99151..99813 [-], 663 | conserved hypothetical protein | ||
| 97 | ICEVCHBAN5_0099 | 99800..100669 [-], 870 | conserved hypothetical protein | ||
| 98 | ICEVCHBAN5_0100 | 100725..100976 [-], 252 | SetQ | ||
| 99 | ICEVCHBAN5_0101 | 101094..101741 [+], 648 | HTH-type transcriptional regulator for conjugative element R391 | ||
| 100 | ICEVCHBAN5_0102 | 101998..102122 [+], 125 | peptide termination factor | ||
(1) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PubMed:20041216] 
|
|
(2) Marrero J; Waldor MK (2007). The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 189(8):3302-5. [PubMed:17307849]
|
| experimental literature |
| in silico analysis literature |