ICEberg
I. Information of ICE
ICEberg ID1068
Name ICEVchNep1 This ICE is derived from experimental literature
ICEO ID ICEO_0000253
OrganismVibrio cholerae O1 VC504
Size (bp)97350
GC content [Genome] (%)46.79
Insertion site-
FunctionAntibiotic resistance genes: floR, strAB, sul2, dfrA1
Species that ICE can be transferred to-
Nucleotide SequenceKC886257 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates528..97877 
Putative oriT region coordinates: 5869..5975;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 41896..44046;   Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEVchNep1 is not available.



The graph information of ICEVchNep1 components from KC886257
Complete gene list of ICEVchNep1 from KC886257
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-528..716 [+], 189hypothetical protein
2-862..2880 [+], 2019DNA mismatch repair protein MutL
3-3010..4251 [-], 1242Mobile element protein
4-4253..4522 [-], 270hypothetical protein
5-4525..5499 [-], 975Rod shape determination protein
6-5595..5762 [+], 168hypothetical protein
7-5807..5941 [+], 135hypothetical protein
8-5964..6407 [+], 444hypothetical protein
9-6418..7590 [-], 1173Error-prone, lesion bypass DNA polymerase V (UmuC)
10-7874..8467 [+], 594Transposase
11-8581..11559 [+], 2979Mobile element protein
12-11674..11865 [+], 192RepA
13-11977..13470 [+], 1494Mobile element protein
14-13672..14385 [+], 714Sul1delta fusion protein
15-14602..15816 [+], 1215Bicyclomycin resistance proteinAR 
16-15871..16149 [+], 279Transcriptional regulator, LysR family
17-16261..16800 [+], 540Mobile element protein
18-16772..17602 [-], 831Aminoglycoside 3'-phosphotransferase 2 / Streptomycin 3'-kinase StrBAR 
19-17608..18411 [-], 804Aminoglycoside 3'-phosphotransferaseAR 
20-18472..19287 [-], 816Dihydropteroate synthaseAR 
21-19758..21110 [+], 1353Mobile element protein
22-21102..22313 [-], 1212Mobile element protein
23-23027..23296 [-], 270Error-prone, lesion bypass DNA polymerase V (UmuC)
24-23389..23754 [-], 366Error-prone repair protein UmuD
25-23753..24010 [+], 258hypothetical protein
26-24394..25299 [+], 906DNA polymerase III, epsilon subunit-like protein
27-25387..25686 [+], 300hypothetical protein
28-26004..26924 [+], 921hypothetical protein
29-26942..27742 [+], 801hypothetical protein
30-27726..28274 [+], 549hypothetical protein
31-28287..31976 [+], 3690hypothetical protein
32-31981..35721 [+], 3741putative type II restriction enzyme methylase subunit
33-35734..38037 [+], 2304hypothetical protein
34-38076..40127 [+], 2052ATP-dependent protease La
35-40154..40924 [+], 771hypothetical protein
36-40959..41774 [+], 816hypothetical protein
37-41896..44046 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
38-44095..45915 [+], 1821IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
39-45949..46485 [+], 537Conjugative transfer protein 234
40-46472..47107 [+], 636Conjugative transfer protein s043
41-47134..47721 [-], 588hypothetical protein
42-48010..48291 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
43-48288..48914 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
44-48898..49536 [+], 639IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
45-49597..49872 [+], 276IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
46-49875..51164 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
47-51161..51811 [+], 651Conjugative transfer protein TraVTraV_F, T4SS component 
48-51808..52194 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
49-52415..53206 [+], 792Ynd
50-53199..54137 [+], 939Ync
51-54269..54961 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
52-54961..57360 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
53-57353..57700 [+], 348Conjugative transfer protein 345
54-57684..58196 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
55-58207..58659 [+], 453IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
56-58782..59441 [+], 660IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
57-59425..60453 [+], 1029IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
58-60456..61364 [+], 909IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
59-61498..62187 [+], 690IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
60-62521..64266 [+], 1746IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
61-64357..65973 [-], 1617ATPase involved in DNA repair
62-66053..66808 [-], 756Mobile element proteinTrbB, T4SS component 
63-66798..68306 [-], 1509Mobile element protein
64-68405..69448 [-], 1044ATPase involved in DNA repair
65-69652..70335 [-], 684Endonuclease I precursor
66-70444..71046 [-], 603hypothetical protein
67-71414..71740 [+], 327hypothetical protein
68-71756..72175 [+], 420Single-stranded DNA-binding protein
69-72255..73073 [+], 819Recombination protein BET
70-73155..73298 [+], 144hypothetical protein
71-73359..74375 [+], 1017hypothetical protein
72-74573..75544 [+], 972Aerobic cobaltochelatase CobS subunit
73-75544..76311 [+], 768hypothetical protein
74-76410..77363 [+], 954Cobalamine biosynthesis protein
75-77425..77865 [+], 441hypothetical protein
76-77935..79590 [+], 1656Plasmid associated gene product APECO1_O1R37
77-79675..80172 [+], 498DNA repair protein RadC
78-80172..80513 [+], 342hypothetical protein
79-80604..81677 [+], 1074putative primase
80-81767..82474 [+], 708hypothetical protein
81-82667..82780 [-], 114hypothetical protein
82-82746..83150 [+], 405Glyoxalase/bleomycin resistance protein/dioxygenase
83-83147..83848 [-], 702hypothetical protein
84-83948..84310 [-], 363hypothetical protein
85-84381..84791 [-], 411hypothetical protein
86-84989..85414 [-], 426hypothetical protein
87-85519..85992 [-], 474Dihydrofolate reductaseAR 
88-86280..87239 [+], 960Mobile element proteinIntegrase 
89-87210..87350 [-], 141hypothetical protein
90-87496..88440 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
91-88443..89831 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
92-89835..93404 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
93-93466..93651 [+], 186hypothetical protein
94-93926..94459 [-], 534Transcriptional activator
95-94456..94755 [-], 300Transcriptional activator
96-94752..95300 [-], 549Soluble lytic murein transglycosylase and related regulatory proteins (some contain LysM/invasin domains)Orf169_F, T4SS component 
97-95287..95949 [-], 663hypothetical protein
98-95936..96805 [-], 870hypothetical protein
99-96861..97112 [-], 252hypothetical protein
100-97230..97877 [+], 648Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins100Fasta
(1) Marin MA; Fonseca EL; Andrade BN; Cabral AC; Vicente AC (2014). Worldwide occurrence of integrative conjugative element encoding multidrug resistance determinants in epidemic Vibrio cholerae O1. PLoS One. 9(9):e108728. [PubMed:25265418]
 

Genomics & Bioinformatics Group in MML, SJTU