ICEberg
I. Information of ICE
ICEberg ID1065
Name ICEVchHai2 This is a predicted ICE derived from literature
OrganismVibrio cholerae HC-1A2
Size (bp)82795
GC content [Genome] (%)45.8
Insertion site-
Function-
Species that ICE can be transferred to-
Nucleotide SequenceAJRO01000008 (complete ICE sequence in this contig)
Replicon-
Coordinates45958..128752 
Putative oriT region coordinates: 51578..51684;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTAGGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 72033..74183; Locus tag: VCHC1A2_1597;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEVchHai2 is not available.



The graph information of ICEVchHai2 components from AJRO01000008
Complete gene list of ICEVchHai2 from AJRO01000008
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1VCHC1A2_157441781..42200 [+], 420SCP-2 sterol transfer family protein
2VCHC1A2_157542184..42687 [+], 504acetyltransferase family protein
3VCHC1A2_157642798..43205 [+], 408DNA polymerase III psi subunit
4rimI43202..43651 [+], 450ribosomal-protein-alanine acetyltransferase
5VCHC1A2_157843640..45697 [-], 2058diguanylate cyclase domain protein
6VCHC1A2_157946857..47084 [+], 228helix-turn-helix family protein
7VCHC1A2_158047077..48291 [+], 1215hipA N-terminal domain protein
8VCHC1A2_158148559..48702 [+], 144hypothetical protein
9VCHC1A2_158248719..49960 [-], 1242phage integrase family protein
10VCHC1A2_158350234..51208 [-], 975hypothetical protein
11VCHC1A2_158451673..52116 [+], 444hypothetical protein
12VCHC1A2_158552127..53395 [-], 1269impB/mucB/samB family protein
13VCHC1A2_158653403..53852 [-], 450peptidase S24-like family protein
14VCHC1A2_158754479..55384 [+], 906exonuclease family protein
15VCHC1A2_158855472..55771 [+], 300hypothetical protein
16VCHC1A2_158956089..57039 [+], 951hypothetical protein
17VCHC1A2_159057056..57856 [+], 801hypothetical protein
18VCHC1A2_159158635..62090 [+], 3456hypothetical protein
19VCHC1A2_159262095..65850 [+], 3756eco57I restriction-modification methylase family protein
20VCHC1A2_159365863..68178 [+], 2316pglZ domain protein
21VCHC1A2_159468217..70268 [+], 2052lon protease (S16) C-terminal proteolytic domain protein
22VCHC1A2_159570457..71065 [+], 609hypothetical protein
23VCHC1A2_159671099..71914 [+], 816hypothetical protein
24VCHC1A2_159772033..74183 [+], 2151helicase family proteinRelaxase, MOBH Family
25traD74232..76052 [+], 1821conjugative coupling factor TraD, SXT/TOL subfamily proteinTraD_F, T4SS component 
26VCHC1A2_159976086..76622 [+], 537hypothetical protein
27VCHC1A2_160076609..77244 [+], 636hypothetical protein
28VCHC1A2_160177383..78489 [+], 1107fic/DOC family protein
29traL78679..78960 [+], 282type IV conjugative transfer system protein TraLTraL_F, T4SS component 
30VCHC1A2_160378969..79583 [+], 615traE family proteinTraE_F, T4SS component 
31VCHC1A2_160479591..80463 [+], 873traK family proteinTraK_F, T4SS component 
32VCHC1A2_160580466..81755 [+], 1290bacterial conjugation TrbI-like family proteinTraB_F, T4SS component 
33traV81752..82402 [+], 651type IV conjugative transfer system protein TraVTraV_F, T4SS component 
34VCHC1A2_160782399..82785 [+], 387hypothetical proteinTraA_F, T4SS component 
35VCHC1A2_160882826..83332 [-], 507acetyltransferase family protein
36VCHC1A2_160983323..83562 [-], 240hypothetical protein
37VCHC1A2_161083958..84650 [+], 693disulfide bond isomerase family proteinTrbB_I, T4SS component 
38traC84651..87050 [+], 2400type-IV secretion system protein TraCTraC_F, T4SS component 
39VCHC1A2_161287070..87390 [+], 321hypothetical protein
40VCHC1A2_161387443..87886 [+], 444peptidase S26 family proteinTraF, T4SS component 
41VCHC1A2_161488008..89021 [+], 1014type-F conjugative transfer system pilin assembly family proteinTraW_F, T4SS component 
42VCHC1A2_161589281..90033 [+], 753traU family proteinTraU_F, T4SS component 
43VCHC1A2_161690036..93728 [+], 3693traN family proteinTraN_F, T4SS component 
44VCHC1A2_161793843..94169 [-], 327putative transposase
45VCHC1A2_161894288..94428 [-], 141hypothetical protein
46VCHC1A2_161994499..95449 [-], 951trp repressor family proteinIntegrase 
47VCHC1A2_162095540..96298 [-], 759transposase DDE domain protein
48VCHC1A2_162196320..96445 [+], 126hypothetical protein
49VCHC1A2_162296767..97696 [+], 930DNA recombination-mediator A family protein
50VCHC1A2_162397693..102369 [+], 4677ATP-dependent DNA helicase, RecQ family protein
51VCHC1A2_1624102366..102854 [+], 489hypothetical protein
52VCHC1A2_1625102947..103063 [+], 117hypothetical protein
53VCHC1A2_1626103133..103810 [-], 678endonuclease I family protein
54VCHC1A2_1627103935..104537 [-], 603hypothetical protein
55VCHC1A2_1628104905..105231 [+], 327hypothetical protein
56VCHC1A2_1629105247..105666 [+], 420single-stranded DNA-binding family protein
57bet105746..106564 [+], 819phage recombination protein Bet
58VCHC1A2_1631106646..106789 [+], 144hypothetical protein
59VCHC1A2_1632106850..107866 [+], 1017putative phage-type endonuclease domain protein
60VCHC1A2_1633108076..109035 [+], 960AAA domain family protein
61VCHC1A2_1634109035..109802 [+], 768hypothetical protein
62VCHC1A2_1635109901..110854 [+], 954hypothetical protein
63VCHC1A2_1636110916..111356 [+], 441hypothetical protein
64VCHC1A2_1637111426..113081 [+], 1656cobalamin biosynthesis CobT family protein
65VCHC1A2_1638113164..113661 [+], 498DNA repair RadC family protein
66VCHC1A2_1639113661..114002 [+], 342hypothetical protein
67VCHC1A2_1640114093..115166 [+], 1074zinc-binding domain of primase-helicase family protein
68VCHC1A2_1641116097..117338 [-], 1242diguanylate cyclase domain protein
69VCHC1A2_1642118089..118997 [+], 909hypothetical proteinTraF_F, T4SS component 
70VCHC1A2_1643119000..120388 [+], 1389conjugative relaxosome accessory transposon family proteinTraH_F, T4SS component 
71VCHC1A2_1644120392..123961 [+], 3570putative traG proteinTraG_F, T4SS component 
72VCHC1A2_1645123994..124116 [-], 123hypothetical protein
73VCHC1A2_1646124480..125013 [-], 534flagellar transcriptional activator family protein
74VCHC1A2_1647125010..125306 [-], 297flagellar transcriptional activator family protein
75VCHC1A2_1648125303..125851 [-], 549transglycosylase SLT domain proteinOrf169_F, T4SS component 
76VCHC1A2_1649125838..126446 [-], 609hypothetical protein
77VCHC1A2_1650126487..127356 [-], 870hypothetical protein
78VCHC1A2_1651127412..127663 [-], 252hypothetical protein
79VCHC1A2_1652127781..128428 [+], 648bacteriophage CI repressor helix-turn-helix domain protein
80prfC128685..130274 [+], 1590peptide chain release factor 3
81VCHC1A2_1654130396..131667 [-], 1272type III restriction enzyme, res subunit
82VCHC1A2_1655131755..132477 [-], 723methyltransferase domain protein
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins74Fasta
(1) Carraro N; Rivard N; Ceccarelli D; Colwell RR; Burrus V (2016). IncA/C Conjugative Plasmids Mobilize a New Family of Multidrug Resistance Islands in Clinical Vibrio cholerae Non-O1/Non-O139 Isolates from Haiti. MBio. 7(4). [PubMed:27435459]
(2) Ceccarelli D; Spagnoletti M; Hasan NA; Lansing S; Huq A; Colwell RR (2013). A new integrative conjugative element detected in Haitian isolates of Vibrio cholerae non-O1/non-O139. Res Microbiol. 164(9):891-893. [PubMed:23994142]
 

Genomics & Bioinformatics Group in MML, SJTU