ICEberg
I. Information of ICE
ICEberg ID1064
Name ICEVchChnAHV1003 This is a predicted ICE derived from literature
OrganismVibrio cholerae AHV1003
Size (bp)101856
GC content [Genome] (%)47.45
Insertion site-
FunctionAntibiotic resistance genes: dfrA1, bcr, sul2, strAB, tetAR, mphRK, mrx
Species that ICE can be transferred to-
Nucleotide SequenceKT151663 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..101856 
Putative oriT region coordinates: 95960..96066;   oriTDB id:  200056
TTCCCCATCCAATTAACCCCTAAAGCCAAAACCACTATCCGTTTGGCTTTTGGATCGAAACGCCAAACGT
AAAACTGCCGTCACAATCACTGTTTGGCGTCTCGATA
Putative relaxase coordinates: 53291..55441; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEVchChnAHV1003 is not available.



The graph information of ICEVchChnAHV1003 components from KT151663
Complete gene list of ICEVchChnAHV1003 from KT151663
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1setR325..972 [-], 648SetR
2-1090..1341 [+], 252hypothetical protein
3-1397..2266 [+], 870hypothetical protein
4-2253..2915 [+], 663hypothetical protein
5-2902..3450 [+], 549hypothetical proteinOrf169_F, T4SS component 
6setD3447..3746 [+], 300SetD
7setC3743..4276 [+], 534SetC
8eexR14334..4765 [+], 432EexR1
9traG4798..8367 [-], 3570plasmid conjugative transfer proteinTraG_F, T4SS component 
10traH8371..9759 [-], 1389plasmid conjugative transfer pilus assembly protein trahTraH_F, T4SS component 
11traF9762..10706 [-], 945plasmid conjugative transfer pilus assembly protein trafTraF_F, T4SS component 
12-10852..10992 [+], 141hypothetical protein
13intIPac10963..11922 [-], 960integraseIntegrase 
14dhfR12210..12683 [+], 474dihydrofolate reductaseAR 
15-12788..13213 [+], 426hypothetical protein
16-13411..13821 [+], 411membrane associated protein
17-13892..14254 [+], 363hypothetical protein
18-14354..15055 [+], 702hypothetical protein
19-15052..15456 [-], 405glyoxalase/bleomycin resistance protein/dioxygenase
20-15728..16435 [-], 708hypothetical protein
21-16525..17598 [-], 1074ATPase
22-17689..18030 [-], 342hypothetical protein
23radC18030..18527 [-], 498DNA repair protein
24cobT18611..20266 [-], 1656cobalamin biosynthesis protein
25-20336..20776 [-], 441hypothetical protein
26-20838..21791 [-], 954hypothetical protein
27-21890..22657 [-], 768hypothetical protein
28cobS22657..23733 [-], 1077aerobic cobaltochelatase cobs subunit
29-23826..24842 [-], 1017hypothetical protein
30-24903..25046 [-], 144hypothetical protein
31bet25128..25946 [-], 819recombination protein BET
32ssd26026..26445 [-], 420single-stranded DNA-binding protein
33-26461..26787 [-], 327hypothetical protein
34-27155..27757 [+], 603hypothetical protein
35-27848..28510 [-], 663hypothetical protein
36-28541..28873 [-], 333hypothetical protein
37traN29105..32797 [-], 3693plasmid conjugative transfer proteinTraN_F, T4SS component 
38traU32800..33828 [-], 1029plasmid conjugative transfer pilus assembly protein trauTraU_F, T4SS component 
39traW33812..34936 [-], 1125plasmid conjugative transfer pilus assembly protein trawTraW_F, T4SS component 
40trhF34947..35459 [-], 513conjugative signal peptidaseTraF, T4SS component 
41-35443..35790 [-], 348hypothetical protein
42traC35783..38182 [-], 2400plasmid conjugative transfer pilus assembly protein tracTraC_F, T4SS component 
43-38182..38874 [-], 693thiol:disulfide proteinTrbB_I, T4SS component 
44ync39253..39942 [-], 690ync
45ynd39935..40768 [-], 834ynd
46traA40946..41332 [-], 387conjugative transfer proteinTraA_F, T4SS component 
47traV41329..41979 [-], 651conjugative transfer proteinTraV_F, T4SS component 
48traB41976..43265 [-], 1290plasmid conjugative transfer pilus assembly protein trabTraB_F, T4SS component 
49traK43268..44164 [-], 897plasmid conjugative transfer pilus assembly protein trakTraK_F, T4SS component 
50traE44148..44774 [-], 627plasmid conjugative transfer pilus assembly protein traeTraE_F, T4SS component 
51traL44771..45052 [-], 282plasmid conjugative transfer pilus assembly protein tralTraL_F, T4SS component 
52-45341..45913 [+], 573hypothetical protein
53iSPsy445992..46687 [-], 696ISPsy4 transposition helper protein
54-46763..48034 [-], 1272hypothetical protein
55-47994..48242 [-], 249hypothetical protein
56tnp48402..49958 [-], 1557transposase
57-50230..50865 [-], 636conjugative transfer protein
58-50852..51412 [-], 561conjugative transfer protein
59traD51422..53242 [-], 1821plasmid conjugative transfer proteinTraD_F, T4SS component 
60traI53291..55441 [-], 2151conjugative transfer protein relaxaseRelaxase, MOBH Family
61-55561..56034 [-], 474hypothetical protein
62-56034..56315 [-], 282hypothetical protein
63mrr56409..57263 [-], 855mrr restriction system protein
64mcrC57263..58390 [-], 1128putative McrC protein
65-58390..60588 [-], 2199hypothetical protein
66-60604..63768 [-], 3165type I restriction-modification system restriction subunit r
67bstXI63773..64927 [-], 1155bstXI restriction endonuclease
68-64924..65628 [-], 705type I restriction-modification system specificity subunit s
69-65621..67336 [-], 1716type I restriction-modification system DNA-methyltransferase subunit m
70-67345..68295 [-], 951hypothetical protein
71-68617..68916 [-], 300hypothetical protein
72-69004..69909 [-], 906DNA polymerase III epsilon subunit-like protein
73-70292..70549 [-], 258hypothetical protein
74umuD70548..70997 [+], 450error-prone repair protein
75rumB71005..71274 [+], 270RumB
76-71427..72149 [+], 723hypothetical protein
77tnpA71617..73230 [-], 1614transposase
78-73510..73692 [+], 183hypothetical protein
79sul273701..74516 [+], 816dihydropteroate synthaseAR 
80strA74577..75380 [+], 804aminoglycoside phosphotransferaseAR 
81strB75386..76216 [+], 831streptomycin phosphotransferaseAR 
82insA76188..76727 [-], 540transposase
83tetR76906..77508 [-], 603TetR family transcriptional regulator
84tetA77589..78791 [+], 1203tetracycline efflux proteinAR 
85tnpB79170..80663 [-], 1494transposase
86-81081..84059 [-], 2979transposase
87mphR84876..85460 [-], 585MphR
88mrx85460..86698 [-], 1239mrx protein
89mphK86605..87621 [+], 1017macrolide phosphotransferase K
90-87838..88299 [-], 462hypothetical protein
91-88566..88694 [-], 129hypothetical protein
92tnpA88962..90257 [-], 1296TnpA
93tnp90376..93354 [-], 2979transposase
94tnp93468..94061 [-], 594transposase
95umuC94345..95517 [+], 1173error-prone lesion bypass DNA polymerase V
96-95994..96128 [-], 135hypothetical protein
97-96173..96340 [-], 168hypothetical protein
98-96436..97410 [+], 975hypothetical protein
99-97413..97682 [+], 270hypothetical protein
100int97684..98925 [+], 1242integrase-like protein
101mutL99055..101073 [-], 2019DNA mismatch repair protein
102-101743..101871 [-], 129hypothetical protein
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins101Fasta
(1) Ryan MP; Armshaw P; O'Halloran JA; Pembroke JT (2017). Analysis and comparative genomics of R997, the first SXT/R391 integrative and conjugative element (ICE) of the Indian Sub-Continent. Sci Rep. 7(1):8562. [PubMed:28819148]
(2) Wang R; Yu D; Yue J; Kan B (2016). Variations in SXT elements in epidemic Vibrio cholerae O1 El Tor strains in China. Sci Rep. 6:22733. [PubMed:26956038] in_silico
 
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU