ICEberg
I. Information of ICE
ICEberg ID1053
Name ICEVchCHN1944 This is a predicted ICE derived from literature
OrganismVibrio cholerae ICDC-1944
Size (bp)100703
GC content [Genome] (%)47.45
Insertion site-
FunctionAntibiotic resistance genes: sul2, strAB, dhfR, folR
Species that ICE can be transferred to-
Nucleotide SequenceKT151659 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..100703 
Putative oriT region coordinates: 94813..94919;   oriTDB id:  200056
TTCCCCATCCAATTAACCCCTAAAGCCAAAACCACTATCCGTTTGGCTTTTGGATCGAAACGCCAAACGT
AAAACTGCCGTCACAATCACTGTTTGGCGTCTCGATA
Putative relaxase coordinates: 51458..53608; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEVchCHN1944 is not available.



The graph information of ICEVchCHN1944 components from KT151659
Complete gene list of ICEVchCHN1944 from KT151659
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1setR325..972 [-], 648SetR
2-1090..1341 [+], 252hypothetical protein
3-1397..2266 [+], 870hypothetical protein
4-2253..2915 [+], 663hypothetical protein
5-2902..3450 [+], 549hypothetical proteinOrf169_F, T4SS component 
6setD3447..3746 [+], 300SetD
7setC3743..4276 [+], 534SetC
8eexR14334..4765 [+], 432EexR1
9traG4798..8367 [-], 3570plasmid conjugative transfer proteinTraG_F, T4SS component 
10traH8371..9759 [-], 1389plasmid conjugative transfer pilus assembly protein trahTraH_F, T4SS component 
11traF9762..10706 [-], 945plasmid conjugative transfer pilus assembly protein trafTraF_F, T4SS component 
12pcrA10994..12886 [-], 1893ATP-dependent DNA helicase
13-12883..14847 [-], 1965putative ATP-dependent OLD family endonuclease
14-15021..15197 [-], 177hypothetical protein
15-15355..16062 [-], 708hypothetical protein
16-16152..17225 [-], 1074phage P4 alpha zinc-binding domain protein
17-17317..17658 [-], 342hypothetical protein
18-17658..18155 [-], 498DNA repair protein
19-18238..19893 [-], 1656cobalamin biosynthesis protein
20-19963..20403 [-], 441hypothetical protein
21-20465..21418 [-], 954hypothetical protein
22-21517..22284 [-], 768hypothetical protein
23-22284..23360 [-], 1077hypothetical protein
24-23453..24469 [-], 1017hypothetical protein
25-24530..24673 [-], 144hypothetical protein
26bet24757..25575 [-], 819recombination protein BET
27ssb25655..26074 [-], 420single-stranded DNA-binding protein
28-26090..26416 [-], 327hypothetical protein
29-26419..26547 [+], 129hypothetical protein
30-26784..27386 [+], 603hypothetical protein
31dna27495..28169 [+], 675extracellular deoxyribonuclease dns
32-28234..28752 [-], 519plasmid-related regulatory protein
33-28772..31045 [-], 2274plasmid-related membrane protein
34traN31545..35237 [-], 3693plasmid conjugative transfer proteinTraN_F, T4SS component 
35traU35240..36268 [-], 1029plasmid conjugative transfer pilus assembly protein trauTraU_F, T4SS component 
36traW36252..37376 [-], 1125plasmid conjugative transfer pilus assembly protein trawTraW_F, T4SS component 
37trhF37387..37899 [-], 513conjugative signal peptidaseTraF, T4SS component 
38-37883..38230 [-], 348hypothetical protein
39traC38223..40622 [-], 2400plasmid conjugative transfer pilus assembly protein tracTraC_F, T4SS component 
40-40622..41314 [-], 693thiol:disulfide proteinTrbB_I, T4SS component 
41ync41446..42384 [-], 939ync
42ynd42377..43210 [-], 834ynd
43traA43388..43774 [-], 387conjugative transfer proteinTraA_F, T4SS component 
44traV43771..44421 [-], 651conjugative transfer proteinTraV_F, T4SS component 
45traB44418..45707 [-], 1290plasmid conjugative transfer pilus assembly protein trabTraB_F, T4SS component 
46traK45710..46606 [-], 897plasmid conjugative transfer pilus assembly protein trakTraK_F, T4SS component 
47traE46590..47216 [-], 627plasmid conjugative transfer pilus assembly protein traeTraE_F, T4SS component 
48traL47213..47494 [-], 282plasmid conjugative transfer pilus assembly protein tralTraL_F, T4SS component 
49-47783..48370 [+], 588plasmid relative protein
50-48397..49032 [-], 636conjugative transfer protein
51-49019..49579 [-], 561conjugative transfer protein
52traD49589..51409 [-], 1821plasmid conjugative transfer proteinTraD_F, T4SS component 
53traI51458..53608 [-], 2151conjugative transfer protein relaxaseRelaxase, MOBH Family
54-53730..53894 [+], 165hypothetical protein
55-53857..55992 [-], 2136putative DNA helicaseTraI_F, T4SS component 
56-55998..62420 [-], 6423helicase
57-62613..67583 [-], 4971type II restriction enzyme methylase subunit
58-67586..70513 [-], 2928putative ATP-dependent helicase
59-70540..71463 [-], 924hypothetical protein
60-71781..72080 [-], 300hypothetical protein
61-72168..73073 [-], 906DNA polymerase III epsilon subunit-like protein
62-73456..73713 [-], 258hypothetical protein
63umuD73712..74161 [+], 450error-prone repair protein
64rumB74169..74438 [+], 270RumB
65-74591..75313 [+], 723hypothetical protein
66tnpA74781..76394 [-], 1614transposase
67-76674..76856 [+], 183BstXI
68sul276865..77680 [+], 816dihydropteroate synthaseAR 
69strA77741..78544 [+], 804streptomycin phosphotransferaseAR 
70strB78544..79380 [+], 837streptomycin phosphotransferaseAR 
71tnpB79352..79891 [-], 540putative transposase
72-80003..80308 [-], 306helix-turn-helix multiple antibiotic resistance protein
73-80336..81550 [-], 1215bicyclomycin resistance proteinAR 
74-81767..82651 [-], 885hypothetical protein
75tnp82682..83605 [-], 924transposase
76dhfR84142..84648 [-], 507dihydrofolate reductase
77tnp85000..85923 [-], 924transposase
78dhfR86460..86966 [-], 507dihydrofolate reductase
79tnpB87318..88241 [-], 924transposase
80tnpA89229..92207 [-], 2979transposase
81tnp92321..92914 [-], 594transposase
82umuC93198..94370 [+], 1173error-prone lesion bypass DNA polymerase V
83-94847..94981 [-], 135hypothetical protein
84-95026..95193 [-], 168hypothetical protein
85-95289..96263 [+], 975hypothetical protein
86-96266..96535 [+], 270hypothetical protein
87int96537..97778 [+], 1242integrase-like proteinIntegrase 
88mutL97908..99926 [-], 2019DNA mismatch repair protein
89-100559..100687 [-], 129hypothetical protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins89Fasta
(1) Wang R; Yu D; Yue J; Kan B (2016). Variations in SXT elements in epidemic Vibrio cholerae O1 El Tor strains in China. Sci Rep. 6:22733. [PubMed:26956038] in_silico
 
in_silico in silico analysis literature