ICEberg
I. Information of ICE
ICEberg ID1051
Name ICEVchCHN1627 This is a predicted ICE derived from literature
OrganismVibrio cholerae ICDC-1627
Size (bp)102413
GC content [Genome] (%)47.93
Insertion site-
FunctionAntibiotic resistance genes: sul2, strAB, dhfR, tetAR, merR, folR
Species that ICE can be transferred to-
Nucleotide SequenceKT151657 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..102413 
Putative oriT region coordinates: 96486..96592;   oriTDB id:  200056
TTCCCCATCCAATTAACCCCTAAAGCCAAAACCACTATCCGTTTGGCTTTTGGATCGAAACGCCAAACGT
AAAACTGCCGTCACAATCACTGTTTGGCGTCTCGATA
Putative relaxase coordinates: 51458..53608; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEVchCHN1627 is not available.



The graph information of ICEVchCHN1627 components from KT151657
Complete gene list of ICEVchCHN1627 from KT151657
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-1090..1341 [+], 252hypothetical protein
2-1397..2266 [+], 870hypothetical protein
3-2253..2915 [+], 663hypothetical protein
4-2902..3450 [+], 549hypothetical proteinOrf169_F, T4SS component 
5setD3447..3746 [+], 300SetD
6setC3743..4276 [+], 534SetC
7eexR14334..4765 [+], 432EexR1
8traG4798..8367 [-], 3570plasmid conjugative transfer proteinTraG_F, T4SS component 
9traH8371..9759 [-], 1389plasmid conjugative transfer pilus assembly protein trahTraH_F, T4SS component 
10traF9762..10706 [-], 945plasmid conjugative transfer pilus assembly protein trafTraF_F, T4SS component 
11pcrA10994..12886 [-], 1893ATP-dependent DNA helicase
12-12883..14847 [-], 1965putative ATP-dependent OLD family endonuclease
13-15021..15197 [-], 177hypothetical protein
14-15355..16062 [-], 708hypothetical protein
15-16152..17225 [-], 1074phage P4 alpha zinc-binding domain protein
16-17317..17658 [-], 342hypothetical protein
17-17658..18155 [-], 498DNA repair protein
18-18238..19893 [-], 1656cobalamin biosynthesis protein
19-19963..20403 [-], 441hypothetical protein
20-20465..21418 [-], 954hypothetical protein
21-21517..22284 [-], 768hypothetical protein
22-22284..23360 [-], 1077hypothetical protein
23-23453..24469 [-], 1017hypothetical protein
24-24530..24673 [-], 144hypothetical protein
25bet24757..25575 [-], 819recombination protein BET
26ssb25655..26074 [-], 420single-stranded DNA-binding protein
27-26090..26416 [-], 327hypothetical protein
28-26419..26547 [+], 129hypothetical protein
29-26784..27386 [+], 603hypothetical protein
30dns27495..28169 [+], 675extracellular deoxyribonuclease dns
31-28234..28752 [-], 519plasmid-related regulatory protein
32-28772..31045 [-], 2274plasmid-related membrane protein
33traN31545..35237 [-], 3693plasmid conjugative transfer proteinTraN_F, T4SS component 
34tra35240..36268 [-], 1029plasmid conjugative transfer pilus assembly protein trauTraU_F, T4SS component 
35traW36252..37376 [-], 1125plasmid conjugative transfer pilus assembly protein trawTraW_F, T4SS component 
36trhF37387..37899 [-], 513conjugative signal peptidaseTraF, T4SS component 
37-37883..38230 [-], 348hypothetical protein
38traC38223..40622 [-], 2400plasmid conjugative transfer pilus assembly protein tracTraC_F, T4SS component 
39-40622..41314 [-], 693thiol:disulfide proteinTrbB_I, T4SS component 
40ync41446..42384 [-], 939ync
41ynd42377..43210 [-], 834ynd
42traA43388..43774 [-], 387conjugative transfer proteinTraA_F, T4SS component 
43traV43771..44421 [-], 651conjugative transfer proteinTraV_F, T4SS component 
44traB44418..45707 [-], 1290plasmid conjugative transfer pilus assembly protein trabTraB_F, T4SS component 
45traK45710..46606 [-], 897plasmid conjugative transfer pilus assembly protein trakTraK_F, T4SS component 
46traE46590..47216 [-], 627plasmid conjugative transfer pilus assembly protein traeTraE_F, T4SS component 
47traL47213..47494 [-], 282plasmid conjugative transfer pilus assembly protein tralTraL_F, T4SS component 
48-47783..48370 [+], 588plasmid relative protein
49-48397..49032 [-], 636conjugative transfer protein
50-49019..49579 [-], 561conjugative transfer protein
51traD49589..51409 [-], 1821plasmid conjugative transfer proteinTraD_F, T4SS component 
52traI51458..53608 [-], 2151conjugative transfer protein relaxaseRelaxase, MOBH Family
53-53730..53894 [+], 165hypothetical protein
54-53857..55992 [-], 2136putative DNA helicaseTraI_F, T4SS component 
55-55998..62420 [-], 6423helicase
56-62613..67583 [-], 4971type II restriction enzyme methylase subunit
57-67586..70549 [-], 2964putative ATP-dependent helicase
58-70576..71499 [-], 924hypothetical protein
59-71817..72116 [-], 300hypothetical protein
60-72204..73109 [-], 906DNA polymerase III epsilon subunit-like protein
61-73492..73749 [-], 258hypothetical protein
62umuD73748..74197 [+], 450error-prone repair protein
63rumB74205..74474 [+], 270RumB
64-74627..75349 [+], 723hypothetical protein
65tnpA74817..76430 [-], 1614transposase
66-76710..76892 [+], 183hypothetical protein
67sul276901..77716 [+], 816dihydropteroate synthaseAR 
68strA77777..78580 [+], 804streptomycin phosphotransferaseAR 
69strB78580..79416 [+], 837streptomycin phosphotransferaseAR 
70-79620..80039 [+], 420drug/metabolite transporter superfamily permease
71tetA80071..81270 [-], 1200tetracycline efflux proteinAR 
72tetR81349..82026 [+], 678TetR family transcriptional regulator
73-82217..82483 [+], 267hypothetical protein
74strB82541..83371 [+], 831streptomycin phosphotransferase
75tnpB83343..83882 [-], 540putative transposase
76-83994..84299 [-], 306helix-turn-helix multiple antibiotic resistance protein
77-84327..85541 [-], 1215bicyclomycin resistance proteinAR 
78-85758..86642 [-], 885hypothetical protein
79tnp86673..87596 [-], 924transposase
80dhfR88133..88639 [-], 507dihydrofolate reductase
81tnp88991..90484 [-], 1494transposase
82tnpA90902..93880 [-], 2979transposase
83tnp93994..94587 [-], 594transposase
84umuC94871..96043 [+], 1173error-prone lesion bypass DNA polymerase V
85-96520..96654 [-], 135hypothetical protein
86-96699..96866 [-], 168hypothetical protein
87-96962..97936 [+], 975hypothetical protein
88-97939..98208 [+], 270hypothetical protein
89int98210..99451 [+], 1242integrase-like proteinIntegrase 
90mutL99581..101599 [-], 2019DNA mismatch repair protein
91-102269..102397 [-], 129hypothetical protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins91Fasta
(1) Wang R; Yu D; Yue J; Kan B (2016). Variations in SXT elements in epidemic Vibrio cholerae O1 El Tor strains in China. Sci Rep. 6:22733. [PubMed:26956038] in_silico
 
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU