ICEberg
I. Information of ICE
ICEberg ID1049
Name ICEVchCHN143 This is a predicted ICE derived from literature
OrganismVibrio cholerae ICDC-143
Size (bp)98459
GC content [Genome] (%)47.42
Insertion site-
FunctionAntibiotic resistance genes: sul2, strAB, dhfR, folR
Species that ICE can be transferred to-
Nucleotide SequenceKT151654 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..98459 
Putative oriT region coordinates: 92531..92637;   oriTDB id:  200056
TTCCCCATCCAATTAACCCCTAAAGCCAAAACCACTATCCGTTTGGCTTTTGGATCGAAACGCCAAACGT
AAAACTGCCGTCACAATCACTGTTTGGCGTCTCGATA
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICEVchCHN143 is not available.



The graph information of ICEVchCHN143 components from KT151654
Complete gene list of ICEVchCHN143 from KT151654
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1setR325..972 [-], 648SetR
2-1090..1341 [+], 252hypothetical protein
3-1397..2266 [+], 870hypothetical protein
4-2253..2915 [+], 663hypothetical protein
5-2902..3450 [+], 549hypothetical proteinOrf169_F, T4SS component 
6setD3447..3746 [+], 300SetD
7setC3743..4276 [+], 534SetC
8eexR14334..4765 [+], 432EexR1
9traG4798..8367 [-], 3570plasmid conjugative transfer proteinTraG_F, T4SS component 
10traH8371..9759 [-], 1389plasmid conjugative transfer pilus assembly protein trahTraH_F, T4SS component 
11traF9762..10706 [-], 945plasmid conjugative transfer pilus assembly protein trafTraF_F, T4SS component 
12pcrA10994..12886 [-], 1893ATP-dependent DNA helicase
13-12883..14847 [-], 1965putative ATP-dependent OLD family endonuclease
14-15021..15197 [-], 177hypothetical protein
15-15355..16062 [-], 708hypothetical protein
16-16152..17225 [-], 1074phage P4 alpha zinc-binding domain protein
17-17317..17658 [-], 342hypothetical protein
18-17658..18155 [-], 498DNA repair protein
19-18238..19893 [-], 1656cobalamin biosynthesis protein
20-19963..20403 [-], 441hypothetical protein
21-20465..21418 [-], 954hypothetical protein
22-21517..22284 [-], 768hypothetical protein
23-22284..23360 [-], 1077hypothetical protein
24-23453..24469 [-], 1017hypothetical protein
25-24530..24673 [-], 144hypothetical protein
26bet24757..25575 [-], 819recombination protein BET
27ssdl25655..26074 [-], 420single-stranded DNA-binding protein
28-26090..26416 [-], 327hypothetical protein
29-26419..26547 [+], 129hypothetical protein
30-26784..27386 [+], 603hypothetical protein
31dns27495..28169 [+], 675extracellular deoxyribonuclease dns
32-28234..28752 [-], 519plasmid-related regulatory protein
33-28772..31045 [-], 2274plasmid-related membrane protein
34traN31545..35237 [-], 3693plasmid conjugative transfer proteinTraN_F, T4SS component 
35traU35240..36268 [-], 1029plasmid conjugative transfer pilus assembly protein trauTraU_F, T4SS component 
36traW36252..37376 [-], 1125plasmid conjugative transfer pilus assembly protein trawTraW_F, T4SS component 
37trhF37387..37899 [-], 513conjugative signal peptidaseTraF, T4SS component 
38-37883..38230 [-], 348hypothetical protein
39traC38223..40622 [-], 2400plasmid conjugative transfer pilus assembly protein tracTraC_F, T4SS component 
40-40622..41314 [-], 693thiol:disulfide proteinTrbB_I, T4SS component 
41ync41446..42384 [-], 939ync
42ynd42377..43210 [-], 834ynd
43traA43388..43774 [-], 387conjugative transfer proteinTraA_F, T4SS component 
44traV43771..44421 [-], 651conjugative transfer proteinTraV_F, T4SS component 
45traB44418..45707 [-], 1290plasmid conjugative transfer pilus assembly protein trabTraB_F, T4SS component 
46traK45710..46606 [-], 897plasmid conjugative transfer pilus assembly protein trakTraK_F, T4SS component 
47traE46590..47216 [-], 627plasmid conjugative transfer pilus assembly protein traeTraE_F, T4SS component 
48traL47213..47494 [-], 282plasmid conjugative transfer pilus assembly protein tralTraL_F, T4SS component 
49-47783..48370 [+], 588plasmid relative protein
50-48397..49032 [-], 636conjugative transfer protein
51-49019..49579 [-], 561conjugative transfer protein
52traD49589..51409 [-], 1821plasmid conjugative transfer proteinTraD_F, T4SS component 
53traI51458..53608 [-], 2151conjugative transfer protein relaxase
54-53730..53894 [+], 165hypothetical protein
55-53857..55992 [-], 2136putative DNA helicaseTraI_F, T4SS component 
56-55998..62420 [-], 6423helicase
57-62613..67583 [-], 4971type II restriction enzyme methylase subunit
58-67586..70549 [-], 2964putative ATP-dependent helicase
59-70576..71499 [-], 924hypothetical protein
60-71817..72116 [-], 300hypothetical protein
61-72204..73109 [-], 906DNA polymerase III epsilon subunit-like protein
62-73492..73749 [-], 258hypothetical protein
63umuD73748..74197 [+], 450error-prone repair protein
64rumB74205..74474 [+], 270RumB
65-74627..75349 [+], 723hypothetical protein
66tnpA74817..76430 [-], 1614transposase
67-76710..76892 [+], 183hypothetical protein
68sul276901..77716 [+], 816dihydropteroate synthaseAR 
69strA77777..78580 [+], 804streptomycin phosphotransferaseAR 
70strB78580..79416 [+], 837streptomycin phosphotransferaseAR 
71tnpB79388..79927 [-], 540putative transposase
72-80039..80344 [-], 306hypothetical protein
73-80372..81586 [-], 1215bicyclomycin resistance proteinAR 
74-81803..82687 [-], 885hypothetical protein
75tnp82718..83050 [-], 333transposase
76dhfR84178..84684 [-], 507dihydrofolate reductase
77iSCR285036..86529 [-], 1494transposase
78tnpA86947..89925 [-], 2979transposase
79tnp90039..90632 [-], 594transposase
80umuC90916..92088 [+], 1173error-prone lesion bypass DNA polymerase V
81-92565..92699 [-], 135hypothetical protein
82-92744..92911 [-], 168hypothetical protein
83-93007..93981 [+], 975hypothetical protein
84-93984..94253 [+], 270hypothetical protein
85int94255..95496 [+], 1242integrase-like proteinIntegrase 
86mutL95626..97644 [-], 2019DNA mismatch repair protein
87-98315..98443 [-], 129hypothetical protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins87Fasta
(1) Wang R; Yu D; Yue J; Kan B (2016). Variations in SXT elements in epidemic Vibrio cholerae O1 El Tor strains in China. Sci Rep. 6:22733. [PubMed:26956038] in_silico
 
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU