ICEberg
I. Information of ICE
ICEberg ID1046
Name ICEValHN492 This is a predicted ICE derived from literature
OrganismVibrio alginolyticus HN492
Size (bp)106164
GC content [Genome] (%)46.04
Insertion siteprfC
Function-
Species that ICE can be transferred to-
Nucleotide SequenceKT072769 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..106164 
Putative oriT region coordinates: 5724..5830;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTCGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 38257..40395; Locus tag: ICEValHN492_046;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEValHN492 is not available.



The graph information of ICEValHN492 components from KT072769
Complete gene list of ICEValHN492 from KT072769
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1hipB906..1226 [+], 321putative Antitoxin protein, HipB
2hipA1219..2433 [+], 1215putative toxin protein, HipA
3ICEValHN492_0032583..2696 [-], 114Hypothetical protein
4xis2659..2853 [+], 195Recombination directionality factor, Xis
5int2865..4106 [-], 1242IntegraseIntegrase 
6s0024108..4281 [-], 174Hypothetical protein, S002
7s0034380..5354 [-], 975Rod shape determination protein,S003
8ICEValHN492_0085450..5572 [+], 123Hypothetical protein
9mobI5819..6262 [+], 444Hypothetical protein, MobI
10rumB6273..7541 [-], 1269Error-prone repair protein, RumB
11rumA7549..7998 [-], 450Error-prone repair protein, RumA
12ICEValHN492_0128118..8255 [+], 138Hypothetical protein
13s0248654..9313 [+], 660DNA polymerase III, S024
14ICEValHN492_0149357..10274 [+], 918Transposase
15ICEValHN492_01510312..11352 [+], 1041DDE endonuclease
16ICEValHN492_01611552..12373 [-], 822Transposase
17ICEValHN492_01712652..12867 [+], 216Flp pilus assembly protein
18cpaA13130..13297 [+], 168Type IV prepilin peptidase, CpaA
19cpaB13517..14323 [+], 807Flp pilus assembly protein, CpaB
20cpaC14335..15663 [+], 1329Type II/IV secretion system protein, CpaC
21ICEValHN492_02115660..16190 [+], 531Hypothetical protein
22cpaE16199..17329 [+], 1131Type II/IV secretion system ATPase, CpaE
23cpaF17445..18734 [+], 1290Type II/IV secretion system protein, CpaFTrbB, T4SS component 
24tadB18731..19651 [+], 921Flp pilus assembly protein, TadB
25tadC19641..20549 [+], 909Type II/IV secretion system protein, TadC
26tadD20542..21438 [+], 897Flp pilus assembly protein, TadD
27tadE21419..21937 [+], 519Flp pilus assembly membrane protein, TadE
28tadF21918..22457 [+], 540Flp pilus assembly surface protein, TadF
29tadG22460..23788 [+], 1329Flp pilus assembly protein, TadG
30ICEValHN492_03024156..24797 [+], 642Outer membrane proteinIcmN, T4SS component 
31ICEValHN492_03124845..24994 [+], 150Hypothetical protein
32ICEValHN492_03225383..26321 [+], 939Transposase
33ICEValHN492_03326456..27376 [+], 921Transposase
34ICEValHN492_03427452..28126 [-], 675Two-component system response regulator
35ICEValHN492_03528236..29114 [-], 879Hypothetical protein
36papC29104..31566 [-], 2463P pilus assembly protein, porin, PapC
37ICEValHN492_03731568..32251 [-], 684Hypothetical protein
38papD32248..32979 [-], 732P pilus assembly protein, PapD
39ICEValHN492_03933045..33539 [-], 495Hypothetical protein
40ICEValHN492_04033625..34119 [-], 495Hypothetical protein
41ICEValHN492_04134429..35064 [+], 636Threonine efflux protein
42ICEValHN492_04235074..35196 [-], 123Hypothetical protein
43ICEValHN492_04335305..36117 [+], 8134-hydroxyphenylpyruvate dioxygenase
44ICEValHN492_04436114..37823 [+], 1710Type III restriction endonuclease
45ICEValHN492_04537859..38161 [-], 303Hypothetical protein
46traI38257..40395 [+], 2139Conjugative transfer protein, TraIRelaxase, MOBH Family
47traD40444..42264 [+], 1821Conjugative transfer protein, TraDTraD_F, T4SS component 
48s09142274..42834 [+], 561Conjugative transfer protein, S091
49traJ42821..43456 [+], 636Conjugative transfer protein, TraJ
50ICEValHN492_05043483..44070 [-], 588Hypothetical protein
51traL44359..44640 [+], 282Conjugative transfer pilus assembly protein, TraLTraL_F, T4SS component 
52traE44649..45263 [+], 615Conjugative transfer pilus assembly protein, TraETraE_F, T4SS component 
53traK45247..46143 [+], 897Conjugative transfer pilus assembly protein, TraKTraK_F, T4SS component 
54traB46146..47435 [+], 1290Conjugative transfer pilus assembly protein, TraBTraB_F, T4SS component 
55traV47510..48082 [+], 573Conjugative transfer protein, TraVTraV_F, T4SS component 
56traA48079..48465 [+], 387Conjugative transfer protein, TraATraA_F, T4SS component 
57ICEValHN492_05748506..49012 [-], 507Acetyltransferase
58ICEValHN492_05849003..49269 [-], 267Hypothetical protein
59ICEValHN492_05949580..50683 [-], 1104Transposase
60dsbC50954..51646 [+], 693Thiol:disulfide involved in conjugative transfer,DsbCTrbB_I, T4SS component 
61traC51647..54046 [+], 2400conjugative transfer pilus assembly protein, TraCTraC_F, T4SS component 
62ICEValHN492_06254039..54386 [+], 348Conjugative transfer protein 345
63trhF54439..54882 [+], 444Conjugative signal peptidase, TrhFTraF, T4SS component 
64traW54893..56017 [+], 1125Conjugative transfer pilus assembly protein, TraWTraW_F, T4SS component 
65traU56049..57029 [+], 981Conjugative transfer pilus assembly protein, TraUTraU_F, T4SS component 
66traN57032..60724 [+], 3693Conjugative transfer protein, TraNTraN_F, T4SS component 
67ICEValHN492_06760955..61287 [+], 333Hypothetical protein
68ICEValHN492_06861318..62007 [+], 690Hypothetical protein
69ICEValHN492_06962323..62751 [+], 429Transposase
70ICEValHN492_07062797..63696 [-], 900Transposase
71ICEValHN492_07163928..64230 [-], 303Hypothetical protein
72betT64539..66182 [+], 1644High-affinity choline uptake protein, BetT
73ICEValHN492_07366378..67235 [-], 858Mechanosensitive channel-related protein
74yrbG67313..67795 [-], 483Inner membrane protein, YrbG
75ICEValHN492_07567887..68369 [+], 483Transposase
76ICEValHN492_07668386..68775 [+], 390Transposase
77ICEValHN492_07768756..68881 [+], 126Hypothetical protein
78ICEValHN492_07868979..69188 [+], 210Hypothetical protein
79ICEValHN492_07969389..70693 [+], 1305RNA-dependent DNA polymerase
80ICEValHN492_08070726..71604 [-], 879DDE endonuclease
81ICEValHN492_08171708..73039 [-], 1332Transposase
82s06373167..73769 [-], 603Hypothetical protein, S063
83s08974137..74463 [+], 327Hypothetical protein, S089
84ssb74479..74898 [+], 420Single-stranded DNA-binding protein, Ssb
85bet74978..75796 [+], 819Recombination protein, Bet
86orfZ75878..76021 [+], 144Hypothetical protein, OrfZ
87exo76083..77099 [+], 1017Recombination related exonuclease, Exo
88cobS77309..78268 [+], 960Aerobic cobaltochelatase, CobS
89ICEValHN492_08978271..79035 [+], 765Hypothetical protein
90ICEValHN492_09079134..80087 [+], 954Cobalamine biosynthesis protein
91ICEValHN492_09180149..80589 [+], 441Hypothetical protein
92ICEValHN492_09280659..82314 [+], 1656Plasmid associated protein
93radC82397..82894 [+], 498DNA repair protein, RadC
94ICEValHN492_09482894..83235 [+], 342Hypothetical protein
95ICEValHN492_09583327..84400 [+], 1074Putative primase
96ICEValHN492_09684489..85196 [+], 708Hypothetical protein
97ICEValHN492_09785514..86770 [+], 1257Glucose-1-phosphate adenylyltransferase
98ICEValHN492_09887125..88597 [-], 1473DNA polymerase
99ICEValHN492_09988885..89886 [-], 1002Transposase
100ICEValHN492_10091089..93287 [-], 2199Diguanylate cyclase
101ICEValHN492_10193590..93712 [+], 123Hypothetical protein
102ICEValHN492_10293843..93968 [-], 126Hypothetical protein
103traF93952..94884 [+], 933Conjugative transfer pilus assembly protein, TraFTraF_F, T4SS component 
104traH94887..96275 [+], 1389Conjugative transfer pilus assembly protein, TraHTraH_F, T4SS component 
105traG96279..99848 [+], 3570Conjugative transfer protein, TraGTraG_F, T4SS component 
106eex99881..100312 [-], 432Exclusion system protein, Eex
107setC100367..100900 [-], 534Transcriptional activator, SetC
108setD100897..101196 [-], 300Transcriptional activator, SetD
109ICEValHN492_109101193..101741 [-], 549LysM/invasin proteinOrf169_F, T4SS component 
110s083101728..102390 [-], 663Hypothetical protein, S083
111s084102377..103246 [-], 870Hypothetical protein, S084
112setQ103302..103553 [-], 252Hypothetical protein, SetQ
113setR103671..104318 [+], 648cI prophage repressor protein, SetR
114prfC104575..106164 [+], 1590Peptide chain release factor 3
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins114Fasta
(1) Luo P; He X; Wang Y; Liu Q; Hu C (2016). Comparative genomic analysis of six new-found integrative conjugative elements (ICEs) in Vibrio alginolyticus. BMC Microbiol. 0.721527778. [PubMed:27145747]
 

Genomics & Bioinformatics Group in MML, SJTU