ICEberg
I. Information of ICE
ICEberg ID1045
Name ICEValHN437 This is a predicted ICE derived from literature
OrganismVibrio alginolyticus HN437
Size (bp)94290
GC content [Genome] (%)46.44
Insertion sitetRNA-ser
Function-
Species that ICE can be transferred to-
Nucleotide SequenceKT072771 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..94290 
Putative oriT region coordinates: 3664..3770;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGCTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 19934..22084; Locus tag: ICEValHN437_020;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEValHN437 is not available.



The graph information of ICEValHN437 components from KT072771
Complete gene list of ICEValHN437 from KT072771
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1int421..1653 [+], 1233IntegraseIntegrase 
2xis1738..1929 [+], 192Recombination directionality factor, Xis
3s0022045..2317 [-], 273Hypothetical protein,S002
4s0032320..3294 [-], 975Rod shape determination protein, S003
5ICEValHN437_0053390..3512 [+], 123Hypothetical protein
6mobI3759..4202 [+], 444Hypothetical protein, MobI
7rumB4213..5481 [-], 1269Error-prone repair protein, RumB
8rumA5489..5938 [-], 450Error-prone repair protein, RumA
9s0246579..7484 [+], 906DNA polymerase III, S024
10ICEValHN437_0107731..9110 [+], 1380Transposase
11ICEValHN437_0119107..9238 [-], 132Hypothetical protein
12s0259242..9430 [+], 189Hypothetical protein, S025
13s0269748..10710 [+], 963Hypothetical protein, S026
14hsdM210719..11564 [+], 846DNA-methyltransferase subunit M
15ICEValHN437_01511592..12548 [+], 957Transposase
16hsdM12640..14355 [+], 1716DNA-methyltransferase subunit M,hsdM
17hsdS14357..15628 [+], 1272DNA specificity subunit S, HsdS
18hsdR15643..18882 [+], 3240DNA restriction subunit R, HsdR
19ICEValHN437_01918985..19839 [+], 855Mrr restriction system protein
20traI19934..22084 [+], 2151Conjugative transfer protein, TraIRelaxase, MOBH Family
21traD22133..23953 [+], 1821Conjugative transfer protein, TraDTraD_F, T4SS component 
22s09123963..24523 [+], 561Conjugative transfer protein, S091
23traJ24510..25145 [+], 636Conjugative transfer protein, traJ
24ICEValHN437_02425119..25238 [-], 120Hypothetical protein
25ICEValHN437_02525283..26389 [+], 1107Fic family protein
26ICEValHN437_02626445..26579 [-], 135Hypothetical protein
27higA26591..26881 [-], 291HigA protein
28traL27114..27395 [+], 282Conjugative transfer pilus assembly protein, TraLTraL_F, T4SS component 
29traE27392..28018 [+], 627Conjugative transfer pilus assembly protein, TraETraE_F, T4SS component 
30traK28002..28898 [+], 897Conjugative transfer pilus assembly protein, TraKTraK_F, T4SS component 
31traB28901..30190 [+], 1290Conjugative transfer pilus assembly protein, TraBTraB_F, T4SS component 
32traV30187..30837 [+], 651Conjugative transfer protein, TraVTraV_F, T4SS component 
33traA30834..31220 [+], 387Conjugative transfer protein, TraATraA_F, T4SS component 
34ICEValHN437_03431261..31767 [-], 507Acetyltransferase
35ICEValHN437_03531758..32024 [-], 267Hypothetical protein
36dsbC32440..33132 [+], 693Thiol:disulfide involved in conjugative transfer, DsbCTrbB_I, T4SS component 
37traC33133..35535 [+], 2403Conjugative transfer pilus assembly protein, TraCTraC_F, T4SS component 
38ICEValHN437_03835528..35875 [+], 348Conjugative transfer protein 345
39trhF35859..36371 [+], 513Conjugative signal peptidase, TrhFTraF, T4SS component 
40traW36382..37506 [+], 1125Conjugative transfer pilus assembly protein, TraWTraW_F, T4SS component 
41traU37766..38518 [+], 753Conjugative transfer pilus assembly protein, TraUTraU_F, T4SS component 
42traN38521..42213 [+], 3693Conjugative transfer protein, TraNTraN_F, T4SS component 
43ICEValHN437_04342445..42777 [+], 333Hypothetical protein
44ICEValHN437_04442808..43470 [+], 663Hypothetical protein
45s06343561..44163 [-], 603Hypothetical protein, S063
46s08944531..44857 [+], 327Hypothetical protein, S089
47ssb44873..45292 [+], 420Single-stranded DNA-binding protein, Ssb
48bet45371..46189 [+], 819Recombination protein, Bet
49orfZ46272..46415 [+], 144Hypothetical protein, OrfZ
50exo46476..47492 [+], 1017Recombination related exonuclease, Exo
51cobS47701..48660 [+], 960Aerobic cobaltochelatase CobS subunit
52s08848660..49427 [+], 768Hypothetical protein, S088
53s06849526..50479 [+], 954Cobalamine biosynthesis protein,S068
54s06950541..50981 [+], 441hypothetical protein,S069
55s07051051..52706 [+], 1656Plasmid associated protein, S070
56radC52791..53288 [+], 498DNA repair protein, RadC
57s09253288..53629 [+], 342Hypothetical protein, S092
58s07253721..54794 [+], 1074Putative primase, S072
59s07354883..55014 [+], 132Hypothetical protein, S073
60ICEValHN437_06055411..56367 [+], 957Transposase
61osmC56628..56999 [-], 372Organic hydroperoxide resistance protein,OsmC
62ICEValHN437_06257012..57932 [-], 921Transposase
63ICEValHN437_06358202..58399 [+], 198Hypothetical protein
64ICEValHN437_06458391..59434 [-], 1044DDE endonuclease
65ICEValHN437_06559653..61038 [+], 1386Hypothetical protein
66ICEValHN437_06661393..62559 [+], 1167UDP-glucose dehydrogenase
67ICEValHN437_06762672..63304 [+], 633Hypothetical protein
68ICEValHN437_06863408..64301 [+], 894UTP--glucose-1-phosphate uridylyltransferas
69ICEValHN437_06964369..64710 [-], 342Hypothetical protein
70ICEValHN437_07064727..65185 [-], 459Phage lysine protein
71ICEValHN437_07165178..65480 [-], 303Hypothetical protein
72ICEValHN437_07265754..66323 [+], 570Transcriptional regulator
73ICEValHN437_07366320..66640 [+], 321Hypothetical protein
74ICEValHN437_07466867..67274 [+], 408Hypothetical protein
75ICEValHN437_07567323..68369 [+], 1047Hypothetical protein
76ICEValHN437_07668381..70399 [+], 2019L-Rha alpha-1,3-L- rhamnosyltransferase
77ICEValHN437_07770404..71384 [+], 981Hypothetical protein
78ICEValHN437_07871421..73166 [+], 1746Glycosyl transferase
79kpsT73159..73809 [+], 651Capsular polysaccharide ABC transporter, KpsT
80ICEValHN437_08073849..75585 [+], 1737Sulfate permease
81ICEValHN437_08175674..76588 [+], 915Sulfate adenylyltransferase subunit 2
82ICEValHN437_08276620..77249 [+], 630Adenylylsulfate kinase
83ICEValHN437_08377252..78214 [+], 963Acetyltransferase
84ICEValHN437_08478366..79772 [+], 1407Sulfate adenylyltransferase subunit 1
85ICEValHN437_08579882..80046 [+], 165RecD-like DNA helicase
86ICEValHN437_08680109..80375 [+], 267Hypothetical protein
87ICEValHN437_08780606..82012 [-], 1407Transposase
88ICEValHN437_08882074..82829 [-], 756Transposase
89ICEValHN437_08982929..83627 [+], 699Hypothetical protein
90traF83754..84698 [+], 945Conjugative transfer pilus assembly protein, TraFTraF_F, T4SS component 
91traH84701..86089 [+], 1389Conjugative transfer pilus assembly protein, TraHTraH_F, T4SS component 
92traG86093..89662 [+], 3570Conjugative transfer protein, TraGTraG_F, T4SS component 
93eex89695..90126 [-], 432Exclusion system protein, Eex
94setC90184..90717 [-], 534Transcriptional activator, SetC
95setD90714..91013 [-], 300Transcriptional activator, SetD
96ICEValHN437_09691010..91558 [-], 549LysM/invasin proteinOrf169_F, T4SS component 
97s08391545..92207 [-], 663Hypothetical protein, S083
98s08492194..93063 [-], 870Hypothetical protein, S084
99setQ93119..93370 [-], 252Hypothetical protein, SetQ
100setR93488..94135 [+], 648cI prophage repressor protein, SetR
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins100Fasta
(1) Luo P; He X; Wang Y; Liu Q; Hu C (2016). Comparative genomic analysis of six new-found integrative conjugative elements (ICEs) in Vibrio alginolyticus. BMC Microbiol. 0.721527778. [PubMed:27145747]
 

Genomics & Bioinformatics Group in MML, SJTU