ICEberg ID | 1045 |
Name | ICEValHN437 |
Organism | Vibrio alginolyticus HN437 |
Size (bp) | 94290 |
GC content [Genome] (%) | 46.44 |
Insertion site | tRNA-ser |
Function | - |
Species that ICE can be transferred to | - |
Nucleotide Sequence | KT072771 (complete ICE sequence in this GenBank file) |
Replicon | - |
Coordinates | 1..94290 |
Putative oriT region | coordinates: 3664..3770; oriTDB id: 200056 TATCGAGACGCCAAACAGTGATTGCTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA |
Putative relaxase | coordinates: 19934..22084; Locus tag: ICEValHN437_020; Family: MOBH |
The graph information of ICEValHN437 components from KT072771 | |||||
Complete gene list of ICEValHN437 from KT072771 | |||||
# | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
1 | int | 421..1653 [+], 1233 | Integrase | Integrase | |
2 | xis | 1738..1929 [+], 192 | Recombination directionality factor, Xis | ||
3 | s002 | 2045..2317 [-], 273 | Hypothetical protein,S002 | ||
4 | s003 | 2320..3294 [-], 975 | Rod shape determination protein, S003 | ||
5 | ICEValHN437_005 | 3390..3512 [+], 123 | Hypothetical protein | ||
6 | mobI | 3759..4202 [+], 444 | Hypothetical protein, MobI | ||
7 | rumB | 4213..5481 [-], 1269 | Error-prone repair protein, RumB | ||
8 | rumA | 5489..5938 [-], 450 | Error-prone repair protein, RumA | ||
9 | s024 | 6579..7484 [+], 906 | DNA polymerase III, S024 | ||
10 | ICEValHN437_010 | 7731..9110 [+], 1380 | Transposase | ||
11 | ICEValHN437_011 | 9107..9238 [-], 132 | Hypothetical protein | ||
12 | s025 | 9242..9430 [+], 189 | Hypothetical protein, S025 | ||
13 | s026 | 9748..10710 [+], 963 | Hypothetical protein, S026 | ||
14 | hsdM2 | 10719..11564 [+], 846 | DNA-methyltransferase subunit M | ||
15 | ICEValHN437_015 | 11592..12548 [+], 957 | Transposase | ||
16 | hsdM | 12640..14355 [+], 1716 | DNA-methyltransferase subunit M,hsdM | ||
17 | hsdS | 14357..15628 [+], 1272 | DNA specificity subunit S, HsdS | ||
18 | hsdR | 15643..18882 [+], 3240 | DNA restriction subunit R, HsdR | ||
19 | ICEValHN437_019 | 18985..19839 [+], 855 | Mrr restriction system protein | ||
20 | traI | 19934..22084 [+], 2151 | Conjugative transfer protein, TraI | Relaxase, MOBH Family | |
21 | traD | 22133..23953 [+], 1821 | Conjugative transfer protein, TraD | TraD_F, T4SS component | |
22 | s091 | 23963..24523 [+], 561 | Conjugative transfer protein, S091 | ||
23 | traJ | 24510..25145 [+], 636 | Conjugative transfer protein, traJ | ||
24 | ICEValHN437_024 | 25119..25238 [-], 120 | Hypothetical protein | ||
25 | ICEValHN437_025 | 25283..26389 [+], 1107 | Fic family protein | ||
26 | ICEValHN437_026 | 26445..26579 [-], 135 | Hypothetical protein | ||
27 | higA | 26591..26881 [-], 291 | HigA protein | ||
28 | traL | 27114..27395 [+], 282 | Conjugative transfer pilus assembly protein, TraL | TraL_F, T4SS component | |
29 | traE | 27392..28018 [+], 627 | Conjugative transfer pilus assembly protein, TraE | TraE_F, T4SS component | |
30 | traK | 28002..28898 [+], 897 | Conjugative transfer pilus assembly protein, TraK | TraK_F, T4SS component | |
31 | traB | 28901..30190 [+], 1290 | Conjugative transfer pilus assembly protein, TraB | TraB_F, T4SS component | |
32 | traV | 30187..30837 [+], 651 | Conjugative transfer protein, TraV | TraV_F, T4SS component | |
33 | traA | 30834..31220 [+], 387 | Conjugative transfer protein, TraA | TraA_F, T4SS component | |
34 | ICEValHN437_034 | 31261..31767 [-], 507 | Acetyltransferase | ||
35 | ICEValHN437_035 | 31758..32024 [-], 267 | Hypothetical protein | ||
36 | dsbC | 32440..33132 [+], 693 | Thiol:disulfide involved in conjugative transfer, DsbC | TrbB_I, T4SS component | |
37 | traC | 33133..35535 [+], 2403 | Conjugative transfer pilus assembly protein, TraC | TraC_F, T4SS component | |
38 | ICEValHN437_038 | 35528..35875 [+], 348 | Conjugative transfer protein 345 | ||
39 | trhF | 35859..36371 [+], 513 | Conjugative signal peptidase, TrhF | TraF, T4SS component | |
40 | traW | 36382..37506 [+], 1125 | Conjugative transfer pilus assembly protein, TraW | TraW_F, T4SS component | |
41 | traU | 37766..38518 [+], 753 | Conjugative transfer pilus assembly protein, TraU | TraU_F, T4SS component | |
42 | traN | 38521..42213 [+], 3693 | Conjugative transfer protein, TraN | TraN_F, T4SS component | |
43 | ICEValHN437_043 | 42445..42777 [+], 333 | Hypothetical protein | ||
44 | ICEValHN437_044 | 42808..43470 [+], 663 | Hypothetical protein | ||
45 | s063 | 43561..44163 [-], 603 | Hypothetical protein, S063 | ||
46 | s089 | 44531..44857 [+], 327 | Hypothetical protein, S089 | ||
47 | ssb | 44873..45292 [+], 420 | Single-stranded DNA-binding protein, Ssb | ||
48 | bet | 45371..46189 [+], 819 | Recombination protein, Bet | ||
49 | orfZ | 46272..46415 [+], 144 | Hypothetical protein, OrfZ | ||
50 | exo | 46476..47492 [+], 1017 | Recombination related exonuclease, Exo | ||
51 | cobS | 47701..48660 [+], 960 | Aerobic cobaltochelatase CobS subunit | ||
52 | s088 | 48660..49427 [+], 768 | Hypothetical protein, S088 | ||
53 | s068 | 49526..50479 [+], 954 | Cobalamine biosynthesis protein,S068 | ||
54 | s069 | 50541..50981 [+], 441 | hypothetical protein,S069 | ||
55 | s070 | 51051..52706 [+], 1656 | Plasmid associated protein, S070 | ||
56 | radC | 52791..53288 [+], 498 | DNA repair protein, RadC | ||
57 | s092 | 53288..53629 [+], 342 | Hypothetical protein, S092 | ||
58 | s072 | 53721..54794 [+], 1074 | Putative primase, S072 | ||
59 | s073 | 54883..55014 [+], 132 | Hypothetical protein, S073 | ||
60 | ICEValHN437_060 | 55411..56367 [+], 957 | Transposase | ||
61 | osmC | 56628..56999 [-], 372 | Organic hydroperoxide resistance protein,OsmC | ||
62 | ICEValHN437_062 | 57012..57932 [-], 921 | Transposase | ||
63 | ICEValHN437_063 | 58202..58399 [+], 198 | Hypothetical protein | ||
64 | ICEValHN437_064 | 58391..59434 [-], 1044 | DDE endonuclease | ||
65 | ICEValHN437_065 | 59653..61038 [+], 1386 | Hypothetical protein | ||
66 | ICEValHN437_066 | 61393..62559 [+], 1167 | UDP-glucose dehydrogenase | ||
67 | ICEValHN437_067 | 62672..63304 [+], 633 | Hypothetical protein | ||
68 | ICEValHN437_068 | 63408..64301 [+], 894 | UTP--glucose-1-phosphate uridylyltransferas | ||
69 | ICEValHN437_069 | 64369..64710 [-], 342 | Hypothetical protein | ||
70 | ICEValHN437_070 | 64727..65185 [-], 459 | Phage lysine protein | ||
71 | ICEValHN437_071 | 65178..65480 [-], 303 | Hypothetical protein | ||
72 | ICEValHN437_072 | 65754..66323 [+], 570 | Transcriptional regulator | ||
73 | ICEValHN437_073 | 66320..66640 [+], 321 | Hypothetical protein | ||
74 | ICEValHN437_074 | 66867..67274 [+], 408 | Hypothetical protein | ||
75 | ICEValHN437_075 | 67323..68369 [+], 1047 | Hypothetical protein | ||
76 | ICEValHN437_076 | 68381..70399 [+], 2019 | L-Rha alpha-1,3-L- rhamnosyltransferase | ||
77 | ICEValHN437_077 | 70404..71384 [+], 981 | Hypothetical protein | ||
78 | ICEValHN437_078 | 71421..73166 [+], 1746 | Glycosyl transferase | ||
79 | kpsT | 73159..73809 [+], 651 | Capsular polysaccharide ABC transporter, KpsT | ||
80 | ICEValHN437_080 | 73849..75585 [+], 1737 | Sulfate permease | ||
81 | ICEValHN437_081 | 75674..76588 [+], 915 | Sulfate adenylyltransferase subunit 2 | ||
82 | ICEValHN437_082 | 76620..77249 [+], 630 | Adenylylsulfate kinase | ||
83 | ICEValHN437_083 | 77252..78214 [+], 963 | Acetyltransferase | ||
84 | ICEValHN437_084 | 78366..79772 [+], 1407 | Sulfate adenylyltransferase subunit 1 | ||
85 | ICEValHN437_085 | 79882..80046 [+], 165 | RecD-like DNA helicase | ||
86 | ICEValHN437_086 | 80109..80375 [+], 267 | Hypothetical protein | ||
87 | ICEValHN437_087 | 80606..82012 [-], 1407 | Transposase | ||
88 | ICEValHN437_088 | 82074..82829 [-], 756 | Transposase | ||
89 | ICEValHN437_089 | 82929..83627 [+], 699 | Hypothetical protein | ||
90 | traF | 83754..84698 [+], 945 | Conjugative transfer pilus assembly protein, TraF | TraF_F, T4SS component | |
91 | traH | 84701..86089 [+], 1389 | Conjugative transfer pilus assembly protein, TraH | TraH_F, T4SS component | |
92 | traG | 86093..89662 [+], 3570 | Conjugative transfer protein, TraG | TraG_F, T4SS component | |
93 | eex | 89695..90126 [-], 432 | Exclusion system protein, Eex | ||
94 | setC | 90184..90717 [-], 534 | Transcriptional activator, SetC | ||
95 | setD | 90714..91013 [-], 300 | Transcriptional activator, SetD | ||
96 | ICEValHN437_096 | 91010..91558 [-], 549 | LysM/invasin protein | Orf169_F, T4SS component | |
97 | s083 | 91545..92207 [-], 663 | Hypothetical protein, S083 | ||
98 | s084 | 92194..93063 [-], 870 | Hypothetical protein, S084 | ||
99 | setQ | 93119..93370 [-], 252 | Hypothetical protein, SetQ | ||
100 | setR | 93488..94135 [+], 648 | cI prophage repressor protein, SetR |
(1) Luo P; He X; Wang Y; Liu Q; Hu C (2016). Comparative genomic analysis of six new-found integrative conjugative elements (ICEs) in Vibrio alginolyticus. BMC Microbiol. 0.721527778. [PubMed:27145747] |