![]() | 1044 |
![]() ![]() | ICEValHN396 ![]() |
![]() | Vibrio alginolyticus HN396 |
![]() | 86687 |
![]() | 46.49 |
![]() | tRNA-ser |
![]() | - |
![]() | - |
![]() | KT072770 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..86687 |
![]() ![]() | coordinates: 3663..3769; oriTDB id: 200056 TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA |
![]() ![]() | coordinates: 27634..29784; Locus tag: ICEValHN396_019; Family: MOBH |
The graph information of ICEValHN396 components from KT072770 | |||||
![]() | |||||
Complete gene list of ICEValHN396 from KT072770 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | ICEValHN396_001 | 15..134 [+], 120 | Hypothetical protein | ||
2 | int | 421..1653 [+], 1233 | Integrase | Integrase | |
3 | xis | 1738..1929 [+], 192 | Recombination directionality factor, Xis | ||
4 | s002 | 2045..2317 [-], 273 | Hypothetical protein, S002 | ||
5 | s003 | 2320..3294 [-], 975 | Rod shape determination protein,S003 | ||
6 | ICEValHN396_006 | 3457..3582 [-], 126 | Hypothetical protein | ||
7 | mobI | 3758..4201 [+], 444 | Hypothetical protein, MobI | ||
8 | rumB | 4269..5480 [-], 1212 | Error-prone repair protein, RumB | ||
9 | rumA | 5488..5937 [-], 450 | Error-prone repair protein, RumA | ||
10 | s024 | 6563..7468 [+], 906 | DNA polymerase III, S024 | ||
11 | ICEValHN396_011 | 7841..9220 [+], 1380 | Transposase | ||
12 | ICEValHN396_012 | 9217..9366 [-], 150 | Hypothetical protein | ||
13 | s025 | 9352..9540 [+], 189 | Hypothetical protein,S025 | ||
14 | s026 | 9859..10782 [+], 924 | Hypothetical protein, S026 | ||
15 | ICEValHN396_015 | 10884..13772 [+], 2889 | ATP-dependent helicase | ||
16 | ICEValHN396_016 | 13775..18646 [+], 4872 | Type II restriction enzyme, methylase subunits | ||
17 | ICEValHN396_017 | 18823..25245 [+], 6423 | DEAD/DEAH box helicase | ||
18 | ICEValHN396_018 | 25251..27386 [+], 2136 | Putative DNA helicase | TraI_F, T4SS component | |
19 | rraI | 27634..29784 [+], 2151 | Conjugative transfer protein, TraI | Relaxase, MOBH Family | |
20 | traD | 29832..31667 [+], 1836 | Conjugative transfer protein, TraD | TraD_F, T4SS component | |
21 | ICEValHN396_021 | 31677..32237 [+], 561 | Conjugative transfer protein, S091 | ||
22 | traJ | 32224..32859 [+], 636 | Conjugative transfer protein, TraJ | ||
23 | ICEValHN396_023 | 32997..34103 [+], 1107 | Fic family protein | ||
24 | ICEValHN396_024 | 34159..34293 [-], 135 | Hypothetical protein | ||
25 | hipA | 34299..34595 [-], 297 | HigA protein | ||
26 | traL | 34829..35110 [+], 282 | Conjugative transfer pilus assembly protein, TraL | TraL_F, T4SS component | |
27 | traE | 35119..35733 [+], 615 | Conjugative transfer pilus assembly protein, TraE | TraE_F, T4SS component | |
28 | traK | 35717..36613 [+], 897 | Conjugative transfer pilus assembly protein, TraK | TraK_F, T4SS component | |
29 | traB | 36616..37905 [+], 1290 | Conjugative transfer pilus assembly protein, TraB | TraB_F, T4SS component | |
30 | traV | 37902..38552 [+], 651 | Conjugative transfer protein, TraV | TraV_F, T4SS component | |
31 | traA | 38549..38935 [+], 387 | Conjugative transfer protein, TraA | TraA_F, T4SS component | |
32 | ICEValHN396_032 | 38976..39482 [-], 507 | Acetyltransferase | ||
33 | ICEValHN396_033 | 39473..39739 [-], 267 | Hypothetical protein | ||
34 | dsbC | 40109..40801 [+], 693 | Thiol:disulfide involved in conjugative transfer, dsbC | TrbB_I, T4SS component | |
35 | traC | 40802..43204 [+], 2403 | Conjugative transfer pilus assembly protein, TraC | TraC_F, T4SS component | |
36 | ICEValHN396_036 | 43197..43544 [+], 348 | Conjugative transfer protein 345 | ||
37 | trhF | 43528..44040 [+], 513 | Conjugative signal peptidase, TrhF | TraF, T4SS component | |
38 | traW | 44051..45175 [+], 1125 | Conjugative transfer pilus assembly protein, TraW | TraW_F, T4SS component | |
39 | traU | 45159..46187 [+], 1029 | Conjugative transfer protein, TraU | TraU_F, T4SS component | |
40 | traN | 46190..49882 [+], 3693 | Conjugative transfer protein, TraN | TraN_F, T4SS component | |
41 | ICEValHN396_041 | 50579..50818 [+], 240 | Hypothetical protein | ||
42 | ICEValHN396_042 | 50961..51554 [+], 594 | ATP-binding protein | ||
43 | ICEValHN396_043 | 51759..52163 [+], 405 | putative transcriptional regulator | ||
44 | ICEValHN396_044 | 52477..54027 [+], 1551 | Aerotaxis sensor receptor protein | ||
45 | cheV | 54024..54950 [+], 927 | Chemotaxis protein, CheV | ||
46 | ICEValHN396_046 | 54964..56124 [+], 1161 | GGDEF family protein | ||
47 | ICEValHN396_047 | 56127..57416 [+], 1290 | Methyl-accepting chemotaxis protein | ||
48 | ICEValHN396_048 | 57537..58064 [-], 528 | Transposase | ||
49 | s063 | 58115..58702 [-], 588 | Hypothetical protein,S063 | ||
50 | s089 | 59070..59414 [+], 345 | Hypothetical protein, S089 | ||
51 | ssb | 59411..59830 [+], 420 | Single-stranded DNA-binding protein, Ssb | ||
52 | bet | 59910..60728 [+], 819 | Recombination protein, Bet | ||
53 | orfZ | 60812..60955 [+], 144 | Hypothetical protein, OrfZ | ||
54 | exo | 61016..62032 [+], 1017 | Recombination related exonuclease, Exo | ||
55 | cobS | 62242..63201 [+], 960 | Aerobic cobaltochelatase, CobS | ||
56 | s088 | 63201..63968 [+], 768 | Hypothetical protein,S088 | ||
57 | s068 | 64067..65020 [+], 954 | Cobalamine biosynthesis protein, S068 | ||
58 | s069 | 65082..65522 [+], 441 | Hypothetical protein,S069 | ||
59 | s070 | 65592..67247 [+], 1656 | Plasmid associated protein, S070 | ||
60 | radC | 67331..67828 [+], 498 | DNA repair protein, RadC | ||
61 | s092 | 67828..68169 [+], 342 | Hypothetical protein, S092 | ||
62 | s072 | 68258..69325 [+], 1068 | Putative primase,S072 | ||
63 | s073 | 69414..70121 [+], 708 | Hypothetical protein, S073 | ||
64 | ICEValHN396_064 | 70277..70594 [-], 318 | putative Transposase | ||
65 | recQ | 71022..73151 [+], 2130 | ATP-dependent DNA helicase, RecQ | ||
66 | dprA | 73288..74631 [+], 1344 | DNA recombination-mediator protein A, DprA | ||
67 | ICEValHN396_067 | 74678..74812 [-], 135 | Hypothetical protein | ||
68 | traF | 75055..75999 [+], 945 | Conjugative transfer pilus assembly protein, TraF | TraF_F, T4SS component | |
69 | traH | 76002..77390 [+], 1389 | Conjugative transfer pilus assembly protein, TraH | TraH_F, T4SS component | |
70 | traG | 77394..80963 [+], 3570 | Conjugative transfer protein, TraG | TraG_F, T4SS component | |
71 | eex | 80994..81449 [-], 456 | Exclusion system protein, Eex | ||
72 | ICEValHN396_072 | 81464..82558 [-], 1095 | DDE superfamily endonuclease | ||
73 | setC | 82597..83115 [-], 519 | Transcriptional activator, SetC | ||
74 | setD | 83108..83410 [-], 303 | Transcriptional activator, SetD | ||
75 | ICEValHN396_075 | 83407..83955 [-], 549 | LysM/invasin protein | Orf169_F, T4SS component | |
76 | s083 | 83942..84604 [-], 663 | Hypothetical protein, S083 | ||
77 | s084 | 84591..85460 [-], 870 | Hypothetical protein, S084 | ||
78 | setQ | 85516..85767 [-], 252 | Hypothetical protein, SetQ | ||
79 | setR | 85884..86531 [+], 648 | cI prophage repressor protein, setR |
(1) Luo P; He X; Wang Y; Liu Q; Hu C (2016). Comparative genomic analysis of six new-found integrative conjugative elements (ICEs) in Vibrio alginolyticus. BMC Microbiol. 0.721527778. [PubMed:27145747] |