I. Information of ICE

ICEberg ID	1044
Name	ICEValHN396
Organism	Vibrio alginolyticus HN396
Size (bp)	86687
GC content [Genome] (%)	46.49
Insertion site	tRNA-ser
Function	-
Species that ICE can be transferred to	-
Nucleotide Sequence	KT072770 (complete ICE sequence in this GenBank file)
Replicon	-
Coordinates	1..86687
Putative oriT region	coordinates: 3663..3769;   oriTDB id:  200056 TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase	coordinates: 27634..29784; Locus tag: ICEValHN396_019;  Family:  MOBH

II. ICE interaction with IME/CIME/

The interaction information of ICEValHN396 is not available.

The graph information of ICEValHN396 components from KT072770
Complete gene list of ICEValHN396 from KT072770
#	Gene	Coordinates [+/-], size (bp)	Product  (GenBank annotation)	*Reannotation
1	ICEValHN396_001	15..134 [+], 120	Hypothetical protein
2	int	421..1653 [+], 1233	Integrase	Integrase
3	xis	1738..1929 [+], 192	Recombination directionality factor, Xis
4	s002	2045..2317 [-], 273	Hypothetical protein, S002
5	s003	2320..3294 [-], 975	Rod shape determination protein,S003
6	ICEValHN396_006	3457..3582 [-], 126	Hypothetical protein
7	mobI	3758..4201 [+], 444	Hypothetical protein, MobI
8	rumB	4269..5480 [-], 1212	Error-prone repair protein, RumB
9	rumA	5488..5937 [-], 450	Error-prone repair protein, RumA
10	s024	6563..7468 [+], 906	DNA polymerase III, S024
11	ICEValHN396_011	7841..9220 [+], 1380	Transposase
12	ICEValHN396_012	9217..9366 [-], 150	Hypothetical protein
13	s025	9352..9540 [+], 189	Hypothetical protein,S025
14	s026	9859..10782 [+], 924	Hypothetical protein, S026
15	ICEValHN396_015	10884..13772 [+], 2889	ATP-dependent helicase
16	ICEValHN396_016	13775..18646 [+], 4872	Type II restriction enzyme, methylase subunits
17	ICEValHN396_017	18823..25245 [+], 6423	DEAD/DEAH box helicase
18	ICEValHN396_018	25251..27386 [+], 2136	Putative DNA helicase	TraI_F, T4SS component
19	rraI	27634..29784 [+], 2151	Conjugative transfer protein, TraI	Relaxase, MOBH Family
20	traD	29832..31667 [+], 1836	Conjugative transfer protein, TraD	TraD_F, T4SS component
21	ICEValHN396_021	31677..32237 [+], 561	Conjugative transfer protein, S091
22	traJ	32224..32859 [+], 636	Conjugative transfer protein, TraJ
23	ICEValHN396_023	32997..34103 [+], 1107	Fic family protein
24	ICEValHN396_024	34159..34293 [-], 135	Hypothetical protein
25	hipA	34299..34595 [-], 297	HigA protein
26	traL	34829..35110 [+], 282	Conjugative transfer pilus assembly protein, TraL	TraL_F, T4SS component
27	traE	35119..35733 [+], 615	Conjugative transfer pilus assembly protein, TraE	TraE_F, T4SS component
28	traK	35717..36613 [+], 897	Conjugative transfer pilus assembly protein, TraK	TraK_F, T4SS component
29	traB	36616..37905 [+], 1290	Conjugative transfer pilus assembly protein, TraB	TraB_F, T4SS component
30	traV	37902..38552 [+], 651	Conjugative transfer protein, TraV	TraV_F, T4SS component
31	traA	38549..38935 [+], 387	Conjugative transfer protein, TraA	TraA_F, T4SS component
32	ICEValHN396_032	38976..39482 [-], 507	Acetyltransferase
33	ICEValHN396_033	39473..39739 [-], 267	Hypothetical protein
34	dsbC	40109..40801 [+], 693	Thiol:disulfide involved in conjugative transfer, dsbC	TrbB_I, T4SS component
35	traC	40802..43204 [+], 2403	Conjugative transfer pilus assembly protein, TraC	TraC_F, T4SS component
36	ICEValHN396_036	43197..43544 [+], 348	Conjugative transfer protein 345
37	trhF	43528..44040 [+], 513	Conjugative signal peptidase, TrhF	TraF, T4SS component
38	traW	44051..45175 [+], 1125	Conjugative transfer pilus assembly protein, TraW	TraW_F, T4SS component
39	traU	45159..46187 [+], 1029	Conjugative transfer protein, TraU	TraU_F, T4SS component
40	traN	46190..49882 [+], 3693	Conjugative transfer protein, TraN	TraN_F, T4SS component
41	ICEValHN396_041	50579..50818 [+], 240	Hypothetical protein
42	ICEValHN396_042	50961..51554 [+], 594	ATP-binding protein
43	ICEValHN396_043	51759..52163 [+], 405	putative transcriptional regulator
44	ICEValHN396_044	52477..54027 [+], 1551	Aerotaxis sensor receptor protein
45	cheV	54024..54950 [+], 927	Chemotaxis protein, CheV
46	ICEValHN396_046	54964..56124 [+], 1161	GGDEF family protein
47	ICEValHN396_047	56127..57416 [+], 1290	Methyl-accepting chemotaxis protein
48	ICEValHN396_048	57537..58064 [-], 528	Transposase
49	s063	58115..58702 [-], 588	Hypothetical protein,S063
50	s089	59070..59414 [+], 345	Hypothetical protein, S089
51	ssb	59411..59830 [+], 420	Single-stranded DNA-binding protein, Ssb
52	bet	59910..60728 [+], 819	Recombination protein, Bet
53	orfZ	60812..60955 [+], 144	Hypothetical protein, OrfZ
54	exo	61016..62032 [+], 1017	Recombination related exonuclease, Exo
55	cobS	62242..63201 [+], 960	Aerobic cobaltochelatase, CobS
56	s088	63201..63968 [+], 768	Hypothetical protein,S088
57	s068	64067..65020 [+], 954	Cobalamine biosynthesis protein, S068
58	s069	65082..65522 [+], 441	Hypothetical protein,S069
59	s070	65592..67247 [+], 1656	Plasmid associated protein, S070
60	radC	67331..67828 [+], 498	DNA repair protein, RadC
61	s092	67828..68169 [+], 342	Hypothetical protein, S092
62	s072	68258..69325 [+], 1068	Putative primase,S072
63	s073	69414..70121 [+], 708	Hypothetical protein, S073
64	ICEValHN396_064	70277..70594 [-], 318	putative Transposase
65	recQ	71022..73151 [+], 2130	ATP-dependent DNA helicase, RecQ
66	dprA	73288..74631 [+], 1344	DNA recombination-mediator protein A, DprA
67	ICEValHN396_067	74678..74812 [-], 135	Hypothetical protein
68	traF	75055..75999 [+], 945	Conjugative transfer pilus assembly protein, TraF	TraF_F, T4SS component
69	traH	76002..77390 [+], 1389	Conjugative transfer pilus assembly protein, TraH	TraH_F, T4SS component
70	traG	77394..80963 [+], 3570	Conjugative transfer protein, TraG	TraG_F, T4SS component
71	eex	80994..81449 [-], 456	Exclusion system protein, Eex
72	ICEValHN396_072	81464..82558 [-], 1095	DDE superfamily endonuclease
73	setC	82597..83115 [-], 519	Transcriptional activator, SetC
74	setD	83108..83410 [-], 303	Transcriptional activator, SetD
75	ICEValHN396_075	83407..83955 [-], 549	LysM/invasin protein	Orf169_F, T4SS component
76	s083	83942..84604 [-], 663	Hypothetical protein, S083
77	s084	84591..85460 [-], 870	Hypothetical protein, S084
78	setQ	85516..85767 [-], 252	Hypothetical protein, SetQ
79	setR	85884..86531 [+], 648	cI prophage repressor protein, setR

(1) Luo P; He X; Wang Y; Liu Q; Hu C (2016). Comparative genomic analysis of six new-found integrative conjugative elements (ICEs) in Vibrio alginolyticus. BMC Microbiol. 0.721527778. [PubMed:27145747]