ICEberg
I. Information of ICE
ICEberg ID1043
Name ICEValE0601 This is a predicted ICE derived from literature
OrganismVibrio alginolyticus E0601
Size (bp)106165
GC content [Genome] (%)46.04
Insertion siteprfC
Function-
Species that ICE can be transferred to-
Nucleotide SequenceKT072768 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..106165 
Putative oriT region coordinates: 5724..5830;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTCGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 38216..40396; Locus tag: ICEValE0601_046;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEValE0601 is not available.



The graph information of ICEValE0601 components from KT072768
Complete gene list of ICEValE0601 from KT072768
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1hipB906..1226 [+], 321putative Antitoxin protein,HipB
2hipA1219..2433 [+], 1215putative toxin protein, HipA
3ICEValE0601_0032583..2696 [-], 114Hypothetical protein
4xis2659..2853 [+], 195Recombination directionality factor, Xis
5int2865..4106 [-], 1242IntergraseIntegrase 
6s0024108..4377 [-], 270Hypothetical protein, S002
7s0034380..5354 [-], 975Rod shape determination protein,S003
8ICEValE0601_0085450..5572 [+], 123Hypothetical protein
9mobI5819..6262 [+], 444Hypothetical protein, MobI
10rumB6273..7541 [-], 1269Error-prone repair protein, RumB
11rumA7549..7998 [-], 450Error-prone repair protein, RumA
12ICEValE0601_0128118..8255 [+], 138Hypothetical protein
13s0248654..9313 [+], 660DNA polymerase III, S024
14ICEValE0601_0149357..10274 [+], 918Transposase
15ICEValE0601_01510312..11352 [+], 1041DDE endonuclease
16ICEValE0601_01611552..12373 [-], 822Transposase
17ICEValE0601_01712652..12867 [+], 216Flp pilus assembly protein
18cpaA13025..13297 [+], 273Type IV prepilin peptidase, CpaA
19cpaB13517..14323 [+], 807Flp pilus assembly protein, CpaB
20cpaC14335..15663 [+], 1329Type II/IV secretion system protein, CpaC
21ICEValE0601_02115660..16190 [+], 531Hypothetical protein
22cpaE16199..17449 [+], 1251Type II/IV secretion system ATPase, CpaE
23cpaF17446..18735 [+], 1290Type II/IV secretion system protein, CpaFTrbB, T4SS component 
24tadB18732..19652 [+], 921Flp pilus assembly protein, TadB
25tadC19642..20550 [+], 909Type II/IV secretion system protein, TadC
26tadD20543..21439 [+], 897Flp pilus assembly protein, TadD
27tadE21420..21938 [+], 519Flp pilus assembly membrane protein, TadE
28tadF21919..22458 [+], 540Flp pilus assembly surface protein, TadF
29tadG22461..23789 [+], 1329Flp pilus assembly protein, TadG
30ICEValE0601_03024157..24798 [+], 642Outer membrane proteinIcmN, T4SS component 
31ICEValE0601_03124846..24995 [+], 150Hypothetical protein
32ICEValE0601_03225384..26322 [+], 939Transposase
33ICEValE0601_03326457..27377 [+], 921Transposase
34ICEValE0601_03427453..28127 [-], 675Two-component system response regulator
35ICEValE0601_03528237..29115 [-], 879Hypothetical protein
36papC29105..31567 [-], 2463P pilus assembly protein, porin, PapC
37ICEValE0601_03731569..32252 [-], 684Hypothetical protein
38papD32249..32980 [-], 732P pilus assembly protein, PapD
39ICEValE0601_03933046..33540 [-], 495Hypothetical protein
40ICEValE0601_04033626..34120 [-], 495Hypothetical protein
41ICEValE0601_04134430..35065 [+], 636Threonine efflux protein
42ICEValE0601_04235075..35197 [-], 123Hypothetical protein
43ICEValE0601_04335306..36118 [+], 8134-hydroxyphenylpyruvate dioxygenase
44ICEValE0601_04436115..37824 [+], 1710Type III restriction endonuclease
45ICEValE0601_04537860..38162 [-], 303Hypothetical protein
46traI38216..40396 [+], 2181Conjugative transfer protein, TraIRelaxase, MOBH Family
47traD40445..42265 [+], 1821Conjugative transfer protein, TraDTraD_F, T4SS component 
48s09142275..42835 [+], 561Conjugative transfer protein, S091
49traJ42822..43457 [+], 636Conjugative transfer protein, TraJ
50ICEValE0601_05043484..44071 [-], 588Hypothetical protein
51traL44360..44641 [+], 282Conjugative transfer pilus assembly protein, TraLTraL_F, T4SS component 
52traE44650..45264 [+], 615Conjugative transfer pilus assembly protein, TraETraE_F, T4SS component 
53traK45248..46144 [+], 897Conjugative transfer pilus assembly protein, TraKTraK_F, T4SS component 
54traB46147..47436 [+], 1290Conjugative transfer pilus assembly protein, TraBTraB_F, T4SS component 
55traV47511..48083 [+], 573Conjugative transfer protein, TraVTraV_F, T4SS component 
56traA48080..48466 [+], 387Conjugative transfer protein, TraATraA_F, T4SS component 
57ICEValE0601_05748507..49013 [-], 507Acetyltransferase
58ICEValE0601_05849004..49270 [-], 267Hypothetical protein
59ICEValE0601_05949581..50684 [-], 1104Transposase
60dsbC50955..51647 [+], 693Thiol:disulfide involved in conjugative transfer,DsbCTrbB_I, T4SS component 
61traC51648..54047 [+], 2400Conjugative transfer pilus assembly protein, TraCTraC_F, T4SS component 
62ICEValE0601_06254040..54387 [+], 348Conjugative transfer protein 345
63trhF54440..54883 [+], 444Conjugative signal peptidase, TrhFTraF, T4SS component 
64traW54894..56018 [+], 1125Conjugative transfer pilus assembly protein, TraWTraW_F, T4SS component 
65traU56050..57030 [+], 981Conjugative transfer pilus assembly protein, TraUTraU_F, T4SS component 
66traN57033..60725 [+], 3693Conjugative transfer protein, TraNTraN_F, T4SS component 
67ICEValE0601_06760956..61288 [+], 333Hypothetical protein
68ICEValE0601_06861319..62008 [+], 690Hypothetical protein
69ICEValE0601_06962324..62752 [+], 429Transposase
70ICEValE0601_07062798..63697 [-], 900Transposase
71ICEValE0601_07163929..64231 [-], 303Hypothetical protein
72betT64540..66183 [+], 1644High-affinity choline uptake protein, BetT
73ICEValE0601_07366379..67236 [-], 858Mechanosensitive channel-related protein
74yrbG67314..67796 [-], 483Inner membrane protein, YrbG
75ICEValE0601_07567888..68370 [+], 483Transposase
76ICEValE0601_07668387..68776 [+], 390Transposase
77ICEValE0601_07768757..68882 [+], 126Hypothetical protein
78ICEValE0601_07868980..69189 [+], 210Hypothetical protein
79ICEValE0601_07969390..70694 [+], 1305RNA-dependent DNA polymerase
80ICEValE0601_08070727..71605 [-], 879DDE endonuclease
81ICEValE0601_08171709..73040 [-], 1332Transposase
82ICEValE0601_08273168..73770 [-], 603Hypothetical protein, S063
83s08974138..74464 [+], 327Hypothetical protein,S089
84ssb74480..74899 [+], 420Single-stranded DNA-binding protein,Ssb
85bet74979..75797 [+], 819Recombination protein, Bet
86orfZ75879..76022 [+], 144Hypothetical protein, OrfZ
87exo76084..77100 [+], 1017Recombination related exonuclease, Exo
88cobS77310..78269 [+], 960Aerobic cobaltochelatase, CobS
89ICEValE0601_08978269..79036 [+], 768Hypothetical protein
90ICEValE0601_09079135..80088 [+], 954Cobalamine biosynthesis protein
91ICEValE0601_09180150..80590 [+], 441Hypothetical protein
92ICEValE0601_09280660..82315 [+], 1656Plasmid associated protein
93radC82398..82895 [+], 498DNA repair protein, RadC
94ICEValE0601_09482895..83236 [+], 342Hypothetical protein
95ICEValE0601_09583328..84401 [+], 1074Putative primase
96ICEValE0601_09684490..85197 [+], 708Hypothetical protein
97ICEValE0601_09785515..86771 [+], 1257Glucose-1-phosphate adenylyltransferase
98ICEValE0601_09887126..88598 [-], 1473DNA polymerase
99ICEValE0601_09988886..89887 [-], 1002Transposase
100ICEValE0601_10091090..93288 [-], 2199Diguanylate cyclase
101ICEValE0601_10193591..93713 [+], 123Hypothetical protein
102ICEValE0601_10293844..93969 [-], 126Hypothetical protein
103traF93953..94885 [+], 933Conjugative transfer pilus assembly protein, TraFTraF_F, T4SS component 
104traH94888..96276 [+], 1389Conjugative transfer pilus assembly protein, TraHTraH_F, T4SS component 
105traG96280..99849 [+], 3570Conjugative transfer protein, TraGTraG_F, T4SS component 
106eex99882..100313 [-], 432Exclusion system protein, Eex
107setC100368..100901 [-], 534Transcriptional activator, SetC
108setD100898..101197 [-], 300Transcriptional activator, SetD
109ICEValE0601_109101194..101742 [-], 549LysM/invasin proteinOrf169_F, T4SS component 
110s083101729..102391 [-], 663Hypothetical protein, S083
111s084102378..103247 [-], 870Hypothetical protein, S084
112setQ103303..103554 [-], 252Hypothetical protein, SetQ
113setR103672..104319 [+], 648cI prophage repressor protein, SetR
114prfC104576..106165 [+], 1590Peptide chain release factor 3
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins114Fasta
(1) Luo P; He X; Wang Y; Liu Q; Hu C (2016). Comparative genomic analysis of six new-found integrative conjugative elements (ICEs) in Vibrio alginolyticus. BMC Microbiol. 0.721527778. [PubMed:27145747]
 

Genomics & Bioinformatics Group in MML, SJTU