ICEberg
I. Information of ICE
ICEberg ID1040
Name ICEValA056-1 This is a predicted ICE derived from literature
OrganismVibrio alginolyticus A056
Size (bp)89004
GC content [Genome] (%)46.76
Insertion siteprfC
FunctionAntibiotic resistance genes: strBA, sul2
Species that ICE can be transferred to-
Nucleotide SequenceKR231688 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..89004 
Putative oriT region coordinates: 4724..4830;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 32530..34680; Locus tag: ICEValA056_029;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEValA056-1 is not available.



The graph information of ICEValA056-1 components from KR231688
Complete gene list of ICEValA056-1 from KR231688
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1ICEValA056_00165..226 [+], 162DNA polymerase III psi subunit
2ICEValA056_002260..694 [+], 435ribosomal-protein-S18p-alanine acetyltransferase
3xis1654..1848 [+], 195recombination directionality factor
4int1865..3106 [-], 1242integraseIntegrase 
5ICEValA056_0053108..3377 [-], 270hypothetical protein
6ICEValA056_0063380..4354 [-], 975rod shape determination protein
7ICEValA056_0074450..4617 [+], 168hypothetical protein
8ICEValA056_0084662..4796 [+], 135hypothetical protein
9mobI4819..5262 [+], 444MobI
10rumB'5273..6265 [-], 993error-prone lesion bypass DNA polymerase RumB
11ICEValA056_0116729..7322 [+], 594transposase
12tnpA7436..10414 [+], 2979mobile element protein
13tnpB10529..10720 [+], 192mobile element protein
14strB11343..12179 [-], 837streptomycin resistance protein BAR 
15strA12179..12982 [-], 804streptomycin resistance protein AAR 
16sul213043..13858 [-], 816dihydropteroate synthaseAR 
17tnpA'14330..15943 [+], 1614mobile element protein
18rumB16286..16555 [-], 270error-prone lesion bypass DNA polymerase
19rumA16563..16985 [-], 423error-prone repair protein
20ICEValA056_02016984..17241 [+], 258hypothetical protein
21ICEValA056_02117625..18530 [+], 906DNA polymerase III epsilon subunit-like protein
22ICEValA056_02218618..18917 [+], 300hypothetical protein
23ICEValA056_02319239..20162 [+], 924hypothetical protein
24ICEValA056_02420243..22063 [+], 1821type III restriction-modification system methylation subunit
25ICEValA056_02522065..24716 [+], 2652type III restriction-modification enzyme helicase subunit
26ICEValA056_02624813..28694 [+], 3882hypothetical protein
27ICEValA056_02728694..31120 [+], 2427hypothetical protein
28ICEValA056_02831192..32373 [+], 1182putative inner membrane protein
29traI32530..34680 [+], 2151conjugative transfer protein TraIRelaxase, MOBH Family
30traD34729..36549 [+], 1821IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
31ICEValA056_03136559..37119 [+], 561conjugative transfer protein 234
32traJ37106..37741 [+], 636conjugative transfer protein TraJ
33ICEValA056_03337813..38451 [+], 639hypothetical protein
34ICEValA056_03438444..39550 [+], 1107transcriptional regulator
35ICEValA056_03539626..40831 [+], 1206mobile element protein
36traL40986..41267 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
37traE41264..41890 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
38traK41874..42770 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
39traB42773..44062 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
40traV44059..44709 [+], 651conjugative transfer protein TraVTraV_F, T4SS component 
41traA44706..45092 [+], 387conjugative transfer protein TraATraA_F, T4SS component 
42ICEValA056_04245133..45639 [-], 507acetyltransferase
43ICEValA056_04345630..45896 [-], 267hypothetical protein
44dsbC46265..46957 [+], 693DsbCTrbB_I, T4SS component 
45traC46958..49357 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
46ICEValA056_04649350..49697 [+], 348conjugative transfer protein 345
47trhF49681..50193 [+], 513conjugative signal peptidase TrhFTraF, T4SS component 
48traW50204..51328 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
49traU51360..52340 [+], 981IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
50traN52343..56035 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
51ICEValA056_05156267..56599 [+], 333hypothetical protein
52ICEValA056_05256630..57292 [+], 663hypothetical protein
53ICEValA056_05357383..57985 [-], 603hypothetical protein
54ICEValA056_05458353..58679 [+], 327hypothetical protein
55ssb58695..59114 [+], 420single-stranded DNA-binding protein
56bet59194..60012 [+], 819recombination protein Bet
57ICEValA056_05760093..60236 [+], 144hypothetical protein
58exo60298..61314 [+], 1017exonuclease
59ICEValA056_05961524..62483 [+], 960aerobic cobaltochelatase CobS subunit
60ICEValA056_06062483..63250 [+], 768hypothetical protein
61ICEValA056_06163349..64302 [+], 954cobalamine biosynthesis protein
62ICEValA056_06264364..64804 [+], 441hypothetical protein
63ICEValA056_06364874..66529 [+], 1656plasmid associated protein
64radC66612..67109 [+], 498DNA repair protein RadC
65ICEValA056_06567109..67450 [+], 342hypothetical protein
66ICEValA056_06667542..68615 [+], 1074putative primase
67ICEValA056_06768705..69412 [+], 708hypothetical protein
68ICEValA056_06869456..69572 [+], 117hypothetical protein
69ICEValA056_06969581..70726 [-], 1146GGDEF domain protein
70ICEValA056_07070974..71450 [-], 477hypothetical protein
71ICEValA056_07171451..74492 [-], 3042acriflavin resistance protein
72ICEValA056_07274492..75622 [-], 1131membrane-fusion protein
73ICEValA056_07375657..76247 [-], 591TetR family transcriptional regulator
74ICEValA056_07476418..76549 [-], 132hypothetical protein
75traF76777..77721 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
76traH77724..79112 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
77traG79116..82685 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
78eexS82718..83149 [-], 432exclusion system protein EexS
79setC83207..83740 [-], 534transcriptional activator SetC
80setD83737..84036 [-], 300transcriptional activator SetD
81ICEValA056_08184033..84581 [-], 549soluble lytic murein transglycosylaseOrf169_F, T4SS component 
82ICEValA056_08284568..85230 [-], 663hypothetical protein
83ICEValA056_08385217..86086 [-], 870hypothetical protein
84ICEValA056_08486142..86393 [-], 252hypothetical protein
85setR86511..87158 [+], 648cI prophage repressor protein SetR
86prfC87415..89004 [+], 1590peptide chain release factor 3
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins86Fasta
(1) Ryan MP; Armshaw P; O'Halloran JA; Pembroke JT (2017). Analysis and comparative genomics of R997, the first SXT/R391 integrative and conjugative element (ICE) of the Indian Sub-Continent. Sci Rep. 7(1):8562. [PubMed:28819148]
(2) Luo P; He X; Wang Y; Liu Q; Hu C (2016). Comparative genomic analysis of six new-found integrative conjugative elements (ICEs) in Vibrio alginolyticus. BMC Microbiol. 0.721527778. [PubMed:27145747]
 

Genomics & Bioinformatics Group in MML, SJTU