ICEberg
I. Information of ICE
ICEberg ID1035
Name ICEPvuCHN2213 This ICE is derived from experimental literature
ICEO ID ICEO_0000252
OrganismProteus vulgaris 08MAS2213
Size (bp)94,340
GC content [Genome] (%)46.77
Insertion site-
FunctionResistance to ampicillin, azithromycin, chloramphenicol, cefazolin, ampicillin-sulbactam, streptomycin, trimethoprim-sulfamethoxazole, sulfamethoxazole
Species that ICE can be transferred to-
Nucleotide SequenceKX243403 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..94340 
Putative oriT region coordinates: 5816..5922;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 39812..41962; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPvuCHN2213 is not available.



The graph information of ICEPvuCHN2213 components from KX243403
Complete gene list of ICEPvuCHN2213 from KX243403
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-475..663 [+], 189hypothetical protein
2mutL809..2827 [+], 2019DNA mismatch repair protein MutL
3int2957..4198 [-], 1242integraseIntegrase 
4-4200..4469 [-], 270hypothetical protein
5-4472..5446 [-], 975Rod shape determination protein
6-5542..5709 [+], 168hypothetical protein
7-5754..5888 [+], 135hypothetical protein
8-5911..6354 [+], 444hypothetical protein
9rumB6365..7537 [-], 1173Error-prone, lesion bypass DNA polymerase V (UmuC)
10tnp7821..8414 [+], 594Transposase
11tnpA8528..11506 [+], 2979Transposase
12tnpB11924..13417 [+], 1494Transposase
13dfhR13769..14275 [+], 507Dihydrofolate reductase
14tnpB14740..15735 [+], 996Transposase
15-15886..16650 [+], 765Type IV secretory pathway, VirD2 components
16floR16867..18081 [+], 1215Bicyclomycin resistance proteinAR 
17-18109..18414 [+], 306LysR family transcriptional regulator
18tnpB18526..19065 [+], 540Transposase
19strB19037..19867 [-], 831streptomycin phosphotransferaseAR 
20strA19873..20439 [-], 567streptomycin phosphotransferase
21sul220737..21552 [-], 816Dihydropteroate synthaseAR 
22tnpA22023..23636 [+], 1614Transposase
23rumB23979..24248 [-], 270Error-prone, lesion bypass DNA polymerase V (UmuC)
24rumA24256..24705 [-], 450Error-prone repair protein UmuD
25-24662..24961 [+], 300hypothetical protein
26-25344..26249 [+], 906DNA polymerase III
27-26337..26636 [+], 300hypothetical protein
28-26958..27908 [+], 951hypothetical protein
29-27917..29632 [+], 1716Type I restriction-modification system, DNA-methyltransferase subunit M
30-29625..30329 [+], 705Type I restriction-modification system, specificity subunit S
31-30326..31480 [+], 1155hypothetical protein
32-31485..34649 [+], 3165Type I restriction-modification system, restriction subunit R
33-34665..36863 [+], 2199enzyme
34-36863..37990 [+], 1128putative mcrC protein
35-37990..38844 [+], 855Mrr restriction system protein
36-38938..39219 [+], 282hypothetical protein
37-39219..39692 [+], 474hypothetical protein
38traI39812..41962 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
39traD42011..43831 [+], 1821IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
40-43841..44401 [+], 561Conjugative transfer protein 234
41-44388..45023 [+], 636Conjugative transfer protein s043
42-45295..46851 [+], 1557Mobile element protein
43-47016..47264 [+], 249hypothetical protein
44-47224..48495 [+], 1272hypothetical protein
45-48571..49266 [+], 696Mobile element protein
46-49345..49917 [-], 573hypothetical protein
47traL50206..50487 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
48traE50484..51110 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
49traK51094..51990 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
50traB51993..53282 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
51traV53279..53929 [+], 651Conjugative transfer protein TraVTraV_F, T4SS component 
52traA53926..54312 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
53ynd54490..55323 [+], 834Ynd
54ync55316..56254 [+], 939Ync
55-56386..57078 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
56traC57078..59477 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
57-59470..59817 [+], 348Conjugative transfer protein 345
58trhF59801..60313 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
59traW60324..61448 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
60traU61432..62460 [+], 1029IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
61traN62463..66155 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
62-66387..66719 [+], 333hypothetical protein
63-66750..67412 [+], 663hypothetical protein
64-67503..68105 [-], 603hypothetical protein
65-68473..68799 [+], 327hypothetical protein
66ssb68815..69234 [+], 420Single-stranded DNA-binding protein
67bet69314..70132 [+], 819Recombination protein BET
68-70214..70357 [+], 144hypothetical protein
69-70418..71434 [+], 1017hypothetical protein
70-71632..72603 [+], 972Aerobic cobaltochelatase CobS subunit
71-72606..73370 [+], 765hypothetical protein
72-73469..74422 [+], 954Cobalamine biosynthesis protein
73-74484..74924 [+], 441hypothetical protein
74-74994..76649 [+], 1656Plasmid associated gene product
75-76733..77230 [+], 498DNA repair protein RadC
76-77230..77571 [+], 342hypothetical protein
77-77662..78735 [+], 1074putative primase
78-78825..79532 [+], 708hypothetical protein
79-79635..81632 [-], 1998hypothetical protein
80-81623..82114 [-], 492hypothetical protein
81-82137..83291 [-], 1155hypothetical protein
82traF83640..84584 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
83traH84587..85975 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
84traG85979..89548 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
85eexS89581..90036 [-], 456EexS
86setC90070..90603 [-], 534Transcriptional activator
87setD90600..90899 [-], 300Transcriptional activator
88-90896..91444 [-], 549Soluble lytic murein transglycosylase and related regulatory proteinsOrf169_F, T4SS component 
89-91431..92093 [-], 663hypothetical protein
90-92080..92949 [-], 870hypothetical protein
91-93005..93256 [-], 252hypothetical protein
92setR93374..94021 [+], 648Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins92Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature