ICEberg
I. Information of ICE
ICEberg ID1033
Name ICEPmiCHN905 This is a predicted ICE derived from literature
OrganismProteus mirabilis MD20140905
Size (bp)94,956
GC content [Genome] (%)47.76
Insertion site-
FunctionResistance to ampicillin, azithromycin, aztreonam, amikacin, chloramphenicol, cefuroxime, cefazolin, ceftriaxone, ciprofloxacin, gentamycin, ampicillin-sulbactam, kanamycin, streptomycin, trimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline
Species that ICE can be transferred to-
Nucleotide SequenceKX243412 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..94956 
Putative oriT region coordinates: 3685..3791;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 37767..39917; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiCHN905 is not available.



The graph information of ICEPmiCHN905 components from KX243412
Complete gene list of ICEPmiCHN905 from KX243412
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-127..270 [-], 144hypothetical protein
2-615..809 [+], 195hypothetical protein
3int826..2067 [-], 1242integraseIntegrase 
4-2069..2338 [-], 270hypothetical protein
5-2341..3315 [-], 975Rod shape determination protein
6-3411..3578 [+], 168hypothetical protein
7-3623..3757 [+], 135hypothetical protein
8-3780..4223 [+], 444hypothetical protein
9rumB4234..5406 [-], 1173Error-prone, lesion bypass DNA polymerase V (UmuC)
10tnp5690..6283 [+], 594Transposase
11tnpA6397..9375 [+], 2979Transposase
12tnpB9793..11286 [+], 1494Transposase
13-11482..12201 [+], 720Type IV secretory pathway, VirD2 components
14floR12418..13632 [+], 1215Bicyclomycin resistance proteinAR 
15-13660..13965 [+], 306LysR family transcriptional regulator
16tnpB14077..14616 [+], 540Transposase
17strB14588..15418 [-], 831streptomycin phosphotransferaseAR 
18strA15424..16227 [-], 804streptomycin phosphotransferaseAR 
19sul216288..17103 [-], 816Dihydropteroate synthaseAR 
20tnpA17574..18662 [+], 1089Transposase
21-18693..19742 [-], 1050hypothetical protein
22-20128..20991 [-], 864Beta-lactamase
23-21022..21153 [+], 132hypothetical protein
24-21367..21495 [+], 129hypothetical protein
25-22210..23115 [+], 906DNA polymerase III
26-23203..23502 [+], 300hypothetical protein
27-23820..24800 [+], 981hypothetical protein
28-24809..26524 [+], 1716Type I restriction-modification system, DNA-methyltransferase subunit M
29-26517..27221 [+], 705Type I restriction-modification system, specificity subunit S
30-27218..28372 [+], 1155hypothetical protein
31-28377..31541 [+], 3165Type I restriction-modification system, restriction subunit R
32-31557..32543 [+], 987hypothetical protein
33tnp32557..33477 [-], 921Mobile element protein
34-33607..34818 [+], 1212enzyme
35-34818..35945 [+], 1128putative mcrC protein
36mrr35945..36799 [+], 855Mrr restriction system protein
37-36893..37174 [+], 282hypothetical protein
38-37174..37647 [+], 474hypothetical protein
39traI37767..39917 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
40traD39966..41786 [+], 1821IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
41-41796..42356 [+], 561Conjugative transfer protein 234
42-42343..42978 [+], 636Conjugative transfer protein s043
43-43005..43592 [-], 588hypothetical protein
44traL43881..44162 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
45traE44159..44785 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
46traK44769..45665 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
47traB45668..46957 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
48traV47032..47604 [+], 573Conjugative transfer protein TraVTraV_F, T4SS component 
49traA47601..47987 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
50ynd48166..48999 [+], 834Ynd
51ync48992..49930 [+], 939Ync
52-50062..50754 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
53traC50754..53153 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
54-53146..53493 [+], 348Conjugative transfer protein 345
55trhF53477..53989 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
56traW54000..55124 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
57traU55156..56136 [+], 981IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
58traN56139..59831 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
59-60290..61708 [+], 1419hypothetical protein
60herA61705..63744 [+], 2040Bipolar DNA helicase HerA
61-63990..64103 [+], 114hypothetical protein
62dns64153..64866 [-], 714Endonuclease I precursor
63-64869..65321 [-], 453Il-IS_2, transposase
64-66070..66582 [-], 513Lipoprotein signal peptidase
65-66586..67365 [-], 780Cobalt-zinc-cadmium resistance protein CzcD
66merR67578..67985 [+], 408Cd(II)/Pb(II)-responsive transcriptional regulator
67-68139..68261 [+], 123hypothetical protein
68-68273..68494 [-], 222hypothetical protein
69-68491..68769 [-], 279Resolvase
70-69035..69163 [+], 129Type IV secretory pathway, VirB4 componentsTfc16, T4SS component 
71tetA69219..70316 [-], 1098Tetracycline efflux protein TetAAR 
72-70299..70439 [+], 141hypothetical protein
73tetR70502..71161 [+], 660tetracycline repressor protein
74-72135..72737 [-], 603hypothetical protein
75-73104..73430 [+], 327hypothetical protein
76ssb73446..73865 [+], 420Single-stranded DNA-binding protein
77bet73945..74763 [+], 819Recombination protein BET
78-74846..74989 [+], 144hypothetical protein
79-75050..76066 [+], 1017hypothetical protein
80-76276..77235 [+], 960Aerobic cobaltochelatase CobS subunit
81-77235..78002 [+], 768hypothetical protein
82-78101..79054 [+], 954Cobalamine biosynthesis protein
83-79116..79556 [+], 441hypothetical protein
84-79626..81281 [+], 1656Plasmid associated gene product
85-81364..81861 [+], 498DNA repair protein RadC
86-81861..82202 [+], 342hypothetical protein
87-82294..83367 [+], 1074putative primase
88-83457..84161 [+], 705hypothetical protein
89traF84254..85198 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
90traH85201..86589 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
91traG86593..90162 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
92eexS90195..90650 [-], 456EexS
93setC90684..91217 [-], 534Transcriptional activator
94setD91214..91513 [-], 300Transcriptional activator
95-91510..92058 [-], 549Soluble lytic murein transglycosylase and related regulatory proteinsOrf169_F, T4SS component 
96-92045..92707 [-], 663hypothetical protein
97-92694..93563 [-], 870hypothetical protein
98-93619..93870 [-], 252hypothetical protein
99setR93988..94635 [+], 648Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins99Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU