ICEberg
I. Information of ICE
ICEberg ID1032
Name ICEPmiCHN904 This is a predicted ICE derived from literature
OrganismProteus mirabilis MD20140904
Size (bp)94,942
GC content [Genome] (%)47.7
Insertion site-
FunctionResistance to ampicillin, azithromycin, aztreonam, amikacin, chloramphenicol, cefuroxime, cefazolin, ceftriaxone, ciprofloxacin, cefepime, ampicillin-sulbactam, kanamycin, streptomycin, trimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline
Species that ICE can be transferred to-
Nucleotide SequenceKX243411 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..94942 
Putative oriT region coordinates: 3685..3791;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 37767..39917; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiCHN904 is not available.



The graph information of ICEPmiCHN904 components from KX243411
Complete gene list of ICEPmiCHN904 from KX243411
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-127..270 [-], 144hypothetical protein
2-615..809 [+], 195hypothetical protein
3int826..2067 [-], 1242integraseIntegrase 
4-2069..2338 [-], 270hypothetical protein
5-2341..3315 [-], 975Rod shape determination protein
6-3411..3578 [+], 168hypothetical protein
7-3623..3757 [+], 135hypothetical protein
8-3780..4223 [+], 444hypothetical protein
9rumB4234..5406 [-], 1173Error-prone, lesion bypass DNA polymerase V (UmuC)
10tnp5690..6283 [+], 594Transposase
11tnpB6964..8457 [+], 1494Transposase
12-8653..9372 [+], 720Type IV secretory pathway, VirD2 components
13floR9589..10803 [+], 1215Bicyclomycin resistance proteinAR 
14-10831..11136 [+], 306LysR family transcriptional regulator
15tnpB11248..11787 [+], 540Transposase
16strB11759..12595 [-], 837streptomycin phosphotransferaseAR 
17strA12595..13398 [-], 804streptomycin phosphotransferaseAR 
18sul213459..14274 [-], 816Dihydropteroate synthaseAR 
19tnpA14985..16097 [+], 1113Transposase
20tnp16089..17300 [-], 1212Transposase
21rumB18014..18283 [-], 270Error-prone, lesion bypass DNA polymerase V (UmuC)
22rumA18291..18539 [-], 249Error-prone repair protein UmuD
23-18693..19742 [-], 1050hypothetical protein
24-20128..20991 [-], 864Beta-lactamase
25-21022..21153 [+], 132hypothetical protein
26-21367..21495 [+], 129hypothetical protein
27-22210..23115 [+], 906DNA polymerase III
28-23203..23502 [+], 300hypothetical protein
29-23820..24800 [+], 981hypothetical protein
30-24809..26524 [+], 1716Type I restriction-modification system
31-26517..27221 [+], 705Type I restriction-modification system, specificity subunit S
32-27218..28372 [+], 1155hypothetical protein
33-28377..31541 [+], 3165Type I restriction-modification system, restriction subunit R
34-31557..32543 [+], 987hypothetical protein
35tnp32557..33477 [-], 921Mobile element protein
36-33607..34818 [+], 1212enzyme
37-34818..35945 [+], 1128putative mcrC protein
38mrr35945..36799 [+], 855Mrr restriction system protein
39-36893..37174 [+], 282hypothetical protein
40-37174..37647 [+], 474hypothetical protein
41traI37767..39917 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
42traD39966..41786 [+], 1821IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
43-41796..42356 [+], 561Conjugative transfer protein 234
44-42343..42978 [+], 636Conjugative transfer protein s043
45-43005..43592 [-], 588hypothetical protein
46traL43881..44162 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
47traE44159..44785 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
48traK44769..45665 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
49traB45668..46957 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
50traV47032..47604 [+], 573Conjugative transfer protein TraVTraV_F, T4SS component 
51traA47601..47987 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
52ynd48166..48999 [+], 834Ynd
53ync48992..49930 [+], 939Ync
54-50062..50754 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
55traC50754..53153 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
56-53146..53493 [+], 348Conjugative transfer protein 345
57trhF53477..53989 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
58traW54000..55124 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
59traU55156..56136 [+], 981IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
60traN56139..59831 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
61-60290..61708 [+], 1419hypothetical protein
62herA61705..63744 [+], 2040Bipolar DNA helicase HerA
63dns64153..64866 [-], 714Endonuclease I precursor
64-64869..65321 [-], 453Il-IS_2, transposase
65-66063..66575 [-], 513Lipoprotein signal peptidase
66-66579..67334 [-], 756Cobalt-zinc-cadmium resistance protein CzcD
67merR67571..67978 [+], 408Cd(II)/Pb(II)-responsive transcriptional regulator
68-68121..68243 [+], 123hypothetical protein
69-68255..68476 [-], 222hypothetical protein
70-68473..68751 [-], 279Resolvase
71-69017..69145 [+], 129Type IV secretory pathway, VirB4 componentsTfc16, T4SS component 
72tetA69201..70391 [-], 1191Tetracycline efflux protein TetAAR 
73tetR70484..71143 [+], 660tetracycline repressor protein
74-72121..72723 [-], 603hypothetical protein
75-73090..73416 [+], 327hypothetical protein
76ssb73432..73851 [+], 420Single-stranded DNA-binding protein
77bet73931..74749 [+], 819Recombination protein BET
78-74832..74975 [+], 144hypothetical protein
79-75036..76052 [+], 1017hypothetical protein
80-76262..77221 [+], 960Aerobic cobaltochelatase CobS subunit
81-77221..77988 [+], 768hypothetical protein
82-78087..79040 [+], 954Cobalamine biosynthesis protein
83-79102..79542 [+], 441hypothetical protein
84-79612..81267 [+], 1656Plasmid associated gene product
85-81350..81847 [+], 498DNA repair protein RadC
86-81847..82188 [+], 342hypothetical protein
87-82280..83353 [+], 1074putative primase
88-83443..84147 [+], 705hypothetical protein
89traF84240..85184 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
90traH85187..86575 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
91traG86579..90148 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
92eexS90181..90636 [-], 456EexS
93setC90670..91203 [-], 534Transcriptional activator
94setD91200..91499 [-], 300Transcriptional activator
95-91496..92044 [-], 549Soluble lytic murein transglycosylase and related regulatory proteinsOrf169_F, T4SS component 
96-92031..92693 [-], 663hypothetical protein
97-92680..93549 [-], 870hypothetical protein
98-93605..93856 [-], 252hypothetical protein
99setR93974..94621 [+], 648Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins99Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU