ICEberg
I. Information of ICE
ICEberg ID1031
Name ICEPmiCHN903 This is a predicted ICE derived from literature
OrganismProteus mirabilis MD20140903
Size (bp)89,644
GC content [Genome] (%)47.27
Insertion site-
FunctionResistance to ampicillin, azithromycin, amikacin, chloramphenicol, cefuroxime, cefazolin, ceftriaxone, ciprofloxacin, ampicillin-sulbactam, kanamycin, streptomycin, trimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline
Species that ICE can be transferred to-
Nucleotide SequenceKX243410 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..89644 
Putative oriT region coordinates: 3685..3791;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 38773..40923; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiCHN903 is not available.



The graph information of ICEPmiCHN903 components from KX243410
Complete gene list of ICEPmiCHN903 from KX243410
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-615..809 [+], 195hypothetical protein
2int826..2067 [-], 1242integraseIntegrase 
3-2069..2338 [-], 270hypothetical protein
4-2341..3315 [-], 975Rod shape determination protein
5-3411..3578 [+], 168hypothetical protein
6-3623..3757 [+], 135hypothetical protein
7-3780..4223 [+], 444hypothetical protein
8rumB4234..5406 [-], 1173Error-prone, lesion bypass DNA polymerase V (UmuC)
9tnp5690..6283 [+], 594Transposase
10tnpA6397..9375 [+], 2979Transposase
11dhfR11638..12144 [+], 507Dihydrofolate reductase
12-13800..14519 [+], 720Type IV secretory pathway, VirD2 components
13floR14736..15950 [+], 1215Bicyclomycin resistance proteinAR 
14-15978..16283 [+], 306LysR family transcriptional regulator
15tnpB16395..16934 [+], 540Transposase
16strB16906..17736 [-], 831streptomycin phosphotransferaseAR 
17strA17742..18545 [-], 804streptomycin phosphotransferaseAR 
18sul218606..19421 [-], 816Dihydropteroate synthaseAR 
19-19609..20748 [-], 1140hypothetical protein
20-21134..21997 [-], 864Beta-lactamase
21-22028..22159 [+], 132hypothetical protein
22-23216..24121 [+], 906DNA polymerase III
23-24209..24508 [+], 300hypothetical protein
24-24826..25806 [+], 981hypothetical protein
25-25815..27530 [+], 1716Type I restriction-modification system
26-27523..28227 [+], 705Type I restriction-modification system, specificity subunit S
27-28224..29378 [+], 1155hypothetical protein
28-29383..32547 [+], 3165Type I restriction-modification system, restriction subunit R
29-32563..33549 [+], 987hypothetical protein
30tnp33563..34483 [-], 921Mobile element protein
31-34613..35824 [+], 1212enzyme
32-35824..36951 [+], 1128putative mcrC protein
33mrr36951..37805 [+], 855Mrr restriction system protein
34-37899..38180 [+], 282hypothetical protein
35-38180..38653 [+], 474hypothetical protein
36traI38773..40923 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
37traD40972..42792 [+], 1821IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
38-42802..43362 [+], 561Conjugative transfer protein 234
39-43349..43984 [+], 636Conjugative transfer protein s043
40-44011..44598 [-], 588hypothetical protein
41traL44887..45168 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
42traE45165..45791 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
43traK45775..46671 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
44traB46674..47963 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
45traV47960..48610 [+], 651Conjugative transfer protein TraVTraV_F, T4SS component 
46traA48607..48993 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
47ynd49172..50005 [+], 834Ynd
48ync49998..50936 [+], 939Ync
49-51068..51760 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
50traC51760..54159 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
51-54152..54499 [+], 348Conjugative transfer protein 345
52trhF54483..54995 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
53traW55006..56130 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
54traU56162..57142 [+], 981IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
55traN57145..60837 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
56-61296..62714 [+], 1419hypothetical protein
57herA62711..64750 [+], 2040Bipolar DNA helicase HerA
58-64996..65109 [+], 114hypothetical protein
59dns65159..65872 [-], 714Endonuclease I precursor
60-65875..66327 [-], 453Il-IS_2, transposase
61-66598..67200 [-], 603hypothetical protein
62-67567..67893 [+], 327hypothetical protein
63ssb67909..68328 [+], 420Single-stranded DNA-binding protein
64bet68408..69226 [+], 819Recombination protein BET
65-69309..69452 [+], 144hypothetical protein
66-69513..70529 [+], 1017hypothetical protein
67-70739..71698 [+], 960Aerobic cobaltochelatase CobS subunit
68-72789..73742 [+], 954Cobalamine biosynthesis protein
69-73804..74244 [+], 441hypothetical protein
70-74314..75969 [+], 1656Plasmid associated gene product
71-76052..76549 [+], 498DNA repair protein RadC
72-76549..76890 [+], 342hypothetical protein
73-76982..78055 [+], 1074putative primase
74-78145..78849 [+], 705hypothetical protein
75traF78942..79886 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
76traH79889..81277 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
77traG81281..84850 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
78eexS84883..85338 [-], 456EexS
79setC85372..85905 [-], 534Transcriptional activator
80setD85902..86201 [-], 300Transcriptional activator
81-86198..86746 [-], 549Soluble lytic murein transglycosylase and related regulatory proteinsOrf169_F, T4SS component 
82-86733..87395 [-], 663hypothetical protein
83-87382..88251 [-], 870hypothetical protein
84-88307..88558 [-], 252hypothetical protein
85setR88676..89323 [+], 648Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins85Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU