ICEberg
I. Information of ICE
ICEberg ID1030
Name ICEPmiCHN902 This is a predicted ICE derived from literature
OrganismProteus mirabilis MD20140902
Size (bp)89,096
GC content [Genome] (%)47.14
Insertion site-
FunctionResistance to ampicillin, azithromycin, aztreonam, amikacin, chloramphenicol, cefuroxime, cefazolin, ceftriaxone, ciprofloxacin, ampicillin-sulbactam, kanamycin, streptomycin, trimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline
Species that ICE can be transferred to-
Nucleotide SequenceKX243409 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..89096 
Putative oriT region coordinates: 3685..3791;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 38773..40923; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiCHN902 is not available.



The graph information of ICEPmiCHN902 components from KX243409
Complete gene list of ICEPmiCHN902 from KX243409
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-127..270 [-], 144hypothetical protein
2-615..809 [+], 195hypothetical protein
3int826..2067 [-], 1242integraseIntegrase 
4-2069..2338 [-], 270hypothetical protein
5-2341..3315 [-], 975Rod shape determination protein
6-3411..3578 [+], 168hypothetical protein
7-3623..3757 [+], 135hypothetical protein
8-3780..4223 [+], 444hypothetical protein
9rumB4234..5406 [-], 1173Error-prone, lesion bypass DNA polymerase V (UmuC)
10tnp5690..6283 [+], 594Transposase
11tnpA6397..9375 [+], 2979Transposase
12dhfR11638..12144 [+], 507Dihydrofolate reductase
13-13800..14519 [+], 720Type IV secretory pathway, VirD2 components
14floR14736..15950 [+], 1215Bicyclomycin resistance proteinAR 
15-15978..16283 [+], 306LysR family transcriptional regulator
16tnpB16395..16934 [+], 540Transposase
17strB16906..17736 [-], 831streptomycin phosphotransferaseAR 
18strA17742..18308 [-], 567streptomycin phosphotransferase
19sul218606..19421 [-], 816Dihydropteroate synthaseAR 
20-19699..20748 [-], 1050hypothetical protein
21-21134..21997 [-], 864Beta-lactamase
22-22028..22159 [+], 132hypothetical protein
23-23216..24121 [+], 906DNA polymerase III
24-24209..24508 [+], 300hypothetical protein
25-24826..25806 [+], 981hypothetical protein
26-25815..27530 [+], 1716Type I restriction-modification system, DNA-methyltransferase subunit M
27-27523..28227 [+], 705Type I restriction-modification system, specificity subunit S
28-28224..29378 [+], 1155hypothetical protein
29-29383..32547 [+], 3165Type I restriction-modification system, restriction subunit R
30-32563..33549 [+], 987hypothetical protein
31tnp33563..34483 [-], 921Mobile element protein
32-34613..35824 [+], 1212enzyme
33-35824..36951 [+], 1128putative mcrC protein
34mrr36951..37805 [+], 855Mrr restriction system protein
35-37899..38180 [+], 282hypothetical protein
36-38180..38653 [+], 474hypothetical protein
37traI38773..40923 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
38traD40972..42792 [+], 1821IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
39-42802..43362 [+], 561Conjugative transfer protein 234
40-43349..43984 [+], 636Conjugative transfer protein s043
41-44011..44598 [-], 588hypothetical protein
42traL44887..45168 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
43traE45177..45791 [+], 615IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
44traK45775..46671 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
45traB46674..47963 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
46traV48038..48610 [+], 573Conjugative transfer protein TraVTraV_F, T4SS component 
47traA48607..48993 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
48ynd49172..50005 [+], 834Ynd
49ync49998..50936 [+], 939Ync
50-51068..51760 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
51traC51760..54159 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
52-54152..54499 [+], 348Conjugative transfer protein 345
53trhF54483..54995 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
54traW55006..56130 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
55traU56162..57142 [+], 981IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
56traN57145..60837 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
57-61296..62714 [+], 1419hypothetical protein
58herA62711..64750 [+], 2040Bipolar DNA helicase HerA
59-64996..65109 [+], 114hypothetical protein
60dns65159..65872 [-], 714Endonuclease I precursor
61-67157..67483 [+], 327hypothetical protein
62ssb67499..67918 [+], 420Single-stranded DNA-binding protein
63bet67998..68816 [+], 819Recombination protein BET
64-68899..69042 [+], 144hypothetical protein
65-69103..70119 [+], 1017hypothetical protein
66-70329..71288 [+], 960Aerobic cobaltochelatase CobS subunit
67-71288..72055 [+], 768hypothetical protein
68-72154..73107 [+], 954Cobalamine biosynthesis protein
69-73169..73609 [+], 441hypothetical protein
70-73679..75334 [+], 1656Plasmid associated gene product
71-75417..75914 [+], 498DNA repair protein RadC
72-75914..76255 [+], 342hypothetical protein
73-76347..77420 [+], 1074putative primase
74-77510..78214 [+], 705hypothetical protein
75traF78307..79251 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
76traH79254..80642 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
77traG80646..84215 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
78eexS84248..84679 [-], 432EexS
79setC84737..85270 [-], 534Transcriptional activator
80setD85267..85566 [-], 300Transcriptional activator
81-85563..86111 [-], 549Soluble lytic murein transglycosylase and related regulatory proteinsOrf169_F, T4SS component 
82-86098..86760 [-], 663hypothetical protein
83-86747..87616 [-], 870hypothetical protein
84-87672..87923 [-], 252hypothetical protein
85setR88521..88775 [+], 255Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins85Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU