ICEberg
I. Information of ICE
ICEberg ID1029
Name ICEPmiCHN901 This is a predicted ICE derived from literature
OrganismProteus mirabilis MD20140901
Size (bp)89,493
GC content [Genome] (%)47.3
Insertion site-
FunctionResistance to ampicillin, azithromycin, aztreonam, amikacin, chloramphenicol, cefuroxime, cefazolin, ceftriaxone, ciprofloxacin, gentamycin, ampicillin-sulbactam, kanamycin, streptomycin, trimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline
Species that ICE can be transferred to-
Nucleotide SequenceKX243408 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..89493 
Putative oriT region coordinates: 3685..3791;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 38804..40954; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiCHN901 is not available.



The graph information of ICEPmiCHN901 components from KX243408
Complete gene list of ICEPmiCHN901 from KX243408
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-127..270 [-], 144hypothetical protein
2-615..809 [+], 195hypothetical protein
3int826..2067 [-], 1242integraseIntegrase 
4-2069..2338 [-], 270hypothetical protein
5-2341..3315 [-], 975Rod shape determination protein
6-3390..3578 [+], 189hypothetical protein
7-3780..4223 [+], 444hypothetical protein
8rumB4234..5406 [-], 1173Error-prone, lesion bypass DNA polymerase V (UmuC)
9tnp5690..6283 [+], 594Transposase
10tnpA6397..9375 [+], 2979Transposase
11tnpB9793..11286 [+], 1494Transposase
12dhfR11638..12144 [+], 507Dihydrofolate reductase
13-13800..14519 [+], 720Type IV secretory pathway, VirD2 components
14floR14736..15950 [+], 1215Bicyclomycin resistance proteinAR 
15-15978..16283 [+], 306LysR family transcriptional regulator
16tnpB16395..16934 [+], 540Transposase
17strB16906..17736 [-], 831streptomycin phosphotransferaseAR 
18strA17742..18545 [-], 804streptomycin phosphotransferaseAR 
19sul218606..19421 [-], 816Dihydropteroate synthaseAR 
20-19699..20748 [-], 1050hypothetical protein
21-21134..21997 [-], 864Beta-lactamase
22-22028..22159 [+], 132hypothetical protein
23rumA22428..22574 [-], 147Error-prone repair protein UmuD
24-23216..24121 [+], 906DNA polymerase III
25-24209..24508 [+], 300hypothetical protein
26-25643..25837 [+], 195hypothetical protein
27-25846..27561 [+], 1716Type I restriction-modification system, DNA-methyltransferase subunit M
28-27554..28258 [+], 705Type I restriction-modification system, specificity subunit S
29-28255..29409 [+], 1155hypothetical protein
30-29414..32578 [+], 3165Type I restriction-modification system, restriction subunit R
31-32594..33580 [+], 987hypothetical protein
32tnp33594..34514 [-], 921Mobile element protein
33-34644..35855 [+], 1212enzyme
34-35855..36982 [+], 1128putative mcrC protein
35mrr36982..37836 [+], 855Mrr restriction system protein
36-37930..38211 [+], 282hypothetical protein
37-38211..38684 [+], 474hypothetical protein
38traI38804..40954 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
39traD41003..42823 [+], 1821IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
40-42833..43393 [+], 561Conjugative transfer protein 234
41-43380..44015 [+], 636Conjugative transfer protein s043
42-44042..44629 [-], 588hypothetical protein
43traL44918..45199 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
44traE45196..45822 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
45traK45806..46702 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
46traB46705..47994 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
47traV48069..48641 [+], 573Conjugative transfer protein TraVTraV_F, T4SS component 
48traA48638..49024 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
49ynd49203..50036 [+], 834Ynd
50ync50029..50967 [+], 939Ync
51-51099..51791 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
52traC52086..54233 [+], 2148IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
53-54226..54573 [+], 348Conjugative transfer protein 345
54trhF54557..55069 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
55traW55080..56204 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
56traU56236..57216 [+], 981IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
57traN57219..60911 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
58-61370..62788 [+], 1419hypothetical protein
59herA62785..64824 [+], 2040Bipolar DNA helicase HerA
60-65070..65183 [+], 114hypothetical protein
61dns65233..65946 [-], 714Endonuclease I precursor
62-65949..66401 [-], 453Il-IS_2, transposase
63-66672..67274 [-], 603hypothetical protein
64-67641..67967 [+], 327hypothetical protein
65ssb67983..68402 [+], 420Single-stranded DNA-binding protein
66bet68482..69300 [+], 819Recombination protein BET
67-69383..69526 [+], 144hypothetical protein
68-69587..70603 [+], 1017hypothetical protein
69-70801..71772 [+], 972Aerobic cobaltochelatase CobS subunit
70-71772..72539 [+], 768hypothetical protein
71-72638..73591 [+], 954Cobalamine biosynthesis protein
72-73653..74093 [+], 441hypothetical protein
73-74163..75818 [+], 1656Plasmid associated gene product
74-75901..76398 [+], 498DNA repair protein RadC
75-76398..76739 [+], 342hypothetical protein
76-76831..77904 [+], 1074putative primase
77-77994..78698 [+], 705hypothetical protein
78traF78791..79735 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
79traH79738..81126 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
80traG81130..84699 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
81eexS84732..85187 [-], 456EexS
82setC85221..85754 [-], 534Transcriptional activator
83setD85751..86050 [-], 300Transcriptional activator
84-86047..86595 [-], 549Soluble lytic murein transglycosylase and related regulatory proteinsOrf169_F, T4SS component 
85-86582..87244 [-], 663hypothetical protein
86-87231..88100 [-], 870hypothetical protein
87-88156..88407 [-], 252hypothetical protein
88setR88525..89172 [+], 648Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins88Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU