ICEberg
I. Information of ICE
ICEberg ID1028
Name ICEPmiChn4 This ICE is derived from experimental literature
ICEO ID ICEO_0000147
OrganismProteus mirabilis JN14
Size (bp)90,566
GC content [Genome] (%)47.54
Insertion site-
FunctionAntibiotic resistance genes: floR, sul2, strAB, chn4-2
Species that ICE can be transferred toEscherichia coli J53
Nucleotide SequenceKY437728 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..90566 
Putative oriT region coordinates: 3990..4096;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 36434..38584; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiChn4 is not available.



The graph information of ICEPmiChn4 components from KY437728
Complete gene list of ICEPmiChn4 from KY437728
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1xis914..1114 [+], 201Xis
2int1131..2372 [-], 1242integrase
3-2374..2643 [-], 270unknown
4-2646..3620 [-], 975hypothetical protein
5rumB4539..5711 [-], 1173UV repair DNA polymerase
6tnp5995..6588 [+], 594putative transposase
7tnpA6702..9680 [+], 2979transposase
8tnpB10098..11591 [+], 1494putative transposase
9-11622..12506 [+], 885hypothetical protein
10floR12723..13937 [+], 1215florfenicol exporterAR 
11lysR13965..14270 [+], 306hypothetical protein
12strB14893..15498 [-], 606streptomycin phosphotransferase protein StrBAR 
13strA15729..16532 [-], 804streptomycin phosphotransferase protein StrAAR 
14sulII16593..17408 [-], 816sulfonamide-resistance dihydropteroate synthase protein Sul2AR 
15-17879..18421 [+], 543transposase
16tnpI18485..18775 [+], 291TnpI transposase
17tnpII18907..19638 [+], 732TnpII transposaseIntegrase 
18chn4-119649..21898 [-], 2250hypothetical protein
19chn4-222284..23147 [-], 864Beta-lactamase
20-23578..23724 [-], 147protein UmuD
21-24366..25271 [+], 906exonuclease, RNase T and DNA polymerase III
22-25485..25784 [+], 300conserved hypothetical protein
23chn4-326016..26201 [+], 186hypothetical protein
24chn4-426229..29297 [+], 3069hypothetical protein
25chn4-529294..29881 [+], 588hypothetical protein
26chn4-629881..32727 [+], 2847DNA methylase
27chn4-732731..35451 [+], 2721hypothetical protein
28traI36434..38584 [+], 2151TraIRelaxase, MOBH Family
29traD38633..40453 [+], 1821TraDTraD_F, T4SS component 
30-40463..41023 [+], 561hypothetical protein
31-41010..41645 [+], 636conjugative transfer protein s043
32enispa1-141717..42343 [+], 627hypothetical protein
33enispa1-242556..43455 [+], 900putative Zn peptidase
34traL43592..43873 [+], 282TraLTraL_F, T4SS component 
35traE44104..44496 [+], 393TraETraE_F, T4SS component 
36traK44477..45376 [+], 900TraKTraK_F, T4SS component 
37traB45379..46668 [+], 1290TraBTraB_F, T4SS component 
38htdD46665..47315 [+], 651HtdDTraV_F, T4SS component 
39traA47312..47698 [+], 387TraATraA_F, T4SS component 
40ynd47877..48710 [+], 834Ynd
41ync48703..49641 [+], 939Ync
42dsbC49773..50465 [+], 693thiol:disulfide interchange protein DsbCTrbB_I, T4SS component 
43traC50465..52864 [+], 2400TraCTraC_F, T4SS component 
44trbI53188..53700 [+], 513TrbITraF, T4SS component 
45traW53711..54835 [+], 1125TraWTraW_F, T4SS component 
46traU54819..55847 [+], 1029TraUTraU_F, T4SS component 
47traN55850..59542 [+], 3693TraNTraN_F, T4SS component 
48chn160001..61419 [+], 1419hypothetical protein
49chn261416..63455 [+], 2040hypothetical protein
50ISPpu12 tnpA64580..65794 [-], 1215putative transposase TnpA
51lspA65891..66403 [-], 513putative lipoprotein signal peptidase LspA
52orf166407..67303 [-], 897putative cation-efflux family protein
53orf267399..67806 [+], 408putative MerR family regulator
54-68036..68638 [-], 603hypothetical protein
55ssb69347..69766 [+], 420single-stranded DNA binding protein
56bet69846..70664 [+], 819recombination protein, Bet
57exo70951..71967 [+], 1017recombination related exonuclease, Exo
58cobS72060..73136 [+], 1077aerobic cobaltochelatase CobS subunit
59-73136..73903 [+], 768hypothetical protein
60-74002..74955 [+], 954hypothetical protein
61-75017..75457 [+], 441hypothetical protein
62-75527..77182 [+], 1656hypothetical protein
63-77265..77762 [+], 498DNA repair protein RadC
64-77762..78103 [+], 342hypothetical protein
65-78195..79268 [+], 1074putative primase
66-79358..80062 [+], 705hypothetical protein
67traF80167..81099 [+], 933TraFTraF_F, T4SS component 
68traH81102..82490 [+], 1389TraHTraH_F, T4SS component 
69traG82494..86063 [+], 3570TraGTraG_F, T4SS component 
70eexS86096..86551 [-], 456EexS
71setC86585..87118 [-], 534transcriptional activator
72setD87115..87414 [-], 300transcriptional activator
73-87411..87959 [-], 549hypothetical proteinOrf169_F, T4SS component 
74-87946..88314 [-], 369hypothetical protein
75-88595..89464 [-], 870hypothetical protein
76-88595..89116 [-], 522hypothetical protein
77-89520..89771 [-], 252hypothetical protein
78setR89889..90536 [+], 648transcriptional repressor
79prfC90793..92382 [+], 1590peptide chain release factor 3
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins78Fasta
(1) Bie L; Wu H; Wang XH; Wang M; Xu H (2017). Identification and characterization of new members of the SXT/R391 family of integrative and conjugative elements (ICEs) in Proteus mirabilis. Int J Antimicrob Agents. 50(2):242-246. [PubMed:28602701] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU