ICEberg
I. Information of ICE
ICEberg ID1026
Name ICEPmiCHN3300 This is a predicted ICE derived from literature
OrganismProteus mirabilis TJ3300
Size (bp)108,335
GC content [Genome] (%)46.69
Insertion site-
FunctionResistance to azithromycin, chloramphenicol, streptomycin, trimethoprim-sulfamethoxazole, sulfamethoxazole
Species that ICE can be transferred to-
Nucleotide SequenceKX243415 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..108335 
Putative oriT region coordinates: 5813..5919;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 45552..47702; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiCHN3300 is not available.



The graph information of ICEPmiCHN3300 components from KX243415
Complete gene list of ICEPmiCHN3300 from KX243415
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-8..136 [+], 129hypothetical protein
2-472..660 [+], 189hypothetical protein
3mutL806..2824 [+], 2019DNA mismatch repair protein MutL
4int2954..4195 [-], 1242integrase
5-4197..4466 [-], 270hypothetical protein
6-4469..5443 [-], 975Rod shape determination protein
7-5539..5706 [+], 168hypothetical protein
8-5908..6351 [+], 444hypothetical protein
9rumB6362..7534 [-], 1173Error-prone, lesion bypass DNA polymerase V (UmuC)
10tnp8664..9842 [-], 1179Transposase
11tnpA10028..11503 [+], 1476Transposase
12tnpB11921..13414 [+], 1494Transposase
13dhfR13766..14272 [+], 507Dihydrofolate reductase
14-14650..14808 [-], 159hypothetical protein
15tnp14809..15732 [+], 924Mobile element protein
16-15763..16647 [+], 885Type IV secretory pathway, VirD2 components
17-16743..16865 [-], 123hypothetical protein
18floR16864..18078 [+], 1215Bicyclomycin resistance proteinAR 
19-18106..18411 [+], 306Transcriptional regulator
20tnpB18523..19062 [+], 540Mobile element protein
21strB19034..19870 [-], 837streptomycin phosphotransferaseAR 
22strA19870..20673 [-], 804streptomycin phosphotransferaseAR 
23sul220734..21549 [-], 816Dihydropteroate synthaseAR 
24tnpA22020..23393 [+], 1374Transposase
25rumB23978..24247 [-], 270Error-prone, lesion bypass DNA polymerase V (UmuC)
26rumA24255..24704 [-], 450Error-prone repair protein UmuD
27-24823..24960 [+], 138hypothetical protein
28-25343..26248 [+], 906DNA polymerase III
29-26447..26650 [+], 204hypothetical protein
30-26758..27645 [+], 888hypothetical protein
31-27655..28254 [+], 600putative inner membrane protein
32-28251..28835 [+], 585putative cytoplasmic protein
33-28854..32531 [+], 3678hypothetical protein
34-32548..34311 [+], 1764hypothetical protein
35-34327..37953 [+], 3627putative type II restriction enzyme methylase subunit
36-37953..40610 [+], 2658putative cytoplasmic protein
37-40627..42702 [+], 2076ATP-dependent protease Type I
38-42746..45397 [+], 2652ATPase involved in DNA repair
39traI45552..47702 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
40traD47751..49571 [+], 1821IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
41-49581..50141 [+], 561Conjugative transfer protein 234
42-50128..50763 [+], 636Conjugative transfer protein s043
43-50790..51377 [-], 588hypothetical protein
44traL51666..51947 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
45traE51944..52570 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
46traK52554..53453 [+], 900IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
47traB53453..54742 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
48traV54739..55389 [+], 651Conjugative transfer protein TraVTraV_F, T4SS component 
49traA55386..55772 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
50ynd55950..56783 [+], 834Ynd
51ync56776..57714 [+], 939Ync
52-58023..58196 [+], 174hypothetical protein
53-58423..61152 [+], 2730putative ATP-dependent helicase
54-61149..62258 [+], 1110hypothetical protein
55-62271..63803 [+], 1533hypothetical protein
56-63806..65251 [+], 1446Response regulator of zinc sigma-54-dependent two-component system
57-65396..66088 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
58traC66088..68487 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
59-68480..68827 [+], 348Conjugative transfer protein 345
60trhF68811..69323 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
61traW69334..70458 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
62traU70442..71470 [+], 1029IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
63traN71473..75165 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
64prcA75288..76964 [-], 1677ATP-dependent DNA helicase pcrA
65-76961..78886 [-], 1926putative exonuclease
66-78964..81342 [-], 2379putative serine protease
67-81358..82329 [-], 972Cell division protein FtsH
68-82440..82619 [-], 180hypothetical protein
69-82761..83363 [-], 603hypothetical protein
70-83773..84057 [+], 285hypothetical protein
71ssb84073..84492 [+], 420Single-stranded DNA-binding protein
72bet84572..85390 [+], 819Recombination protein BET
73-85473..85616 [+], 144hypothetical protein
74-85677..86693 [+], 1017hypothetical protein
75-86903..87862 [+], 960Aerobic cobaltochelatase CobS subunit
76-87865..88629 [+], 765hypothetical protein
77-88728..89681 [+], 954Cobalamine biosynthesis protein
78-89743..90183 [+], 441hypothetical protein
79-90253..91908 [+], 1656Plasmid associated gene product
80-91992..92489 [+], 498DNA repair protein RadC
81-92489..92830 [+], 342hypothetical protein
82-92922..93995 [+], 1074putative primase
83-94084..94791 [+], 708hypothetical protein
84-95022..95162 [+], 141hypothetical protein
85dhfR95651..96124 [-], 474Dihydrofolate reductaseAR 
86-96412..97371 [+], 960intIPacIntegrase 
87traF97633..98577 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
88traH98580..99968 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
89traG99972..103541 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
90eexR103574..104005 [-], 432EexR
91setC104063..104596 [-], 534Transcriptional activator
92setD104593..104892 [-], 300Transcriptional activator
93-104889..105437 [-], 549Soluble lytic murein transglycosylase and related regulatory proteins (some containing LysM/invasin domains)Orf169_F, T4SS component 
94-105424..106086 [-], 663hypothetical protein
95-106073..106942 [-], 870hypothetical protein
96-106998..107249 [-], 252hypothetical protein
97setR107367..108014 [+], 648Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins97Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU