ICEberg
I. Information of ICE
ICEberg ID1024
Name ICEPmiCHN3237 This is a predicted ICE derived from literature
OrganismProteus mirabilis TJ3237
Size (bp)87,215
GC content [Genome] (%)46.76
Insertion site-
FunctionResistance to ampicillin, azithromycin, cefazolin, trimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline
Species that ICE can be transferred to-
Nucleotide SequenceKX243414 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..87215 
Putative oriT region coordinates: 3685..3791;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 33611..35761; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiCHN3237 is not available.



The graph information of ICEPmiCHN3237 components from KX243414
Complete gene list of ICEPmiCHN3237 from KX243414
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-615..809 [+], 195hypothetical protein
2int826..2067 [-], 1242integraseIntegrase 
3-2069..2338 [-], 270hypothetical protein
4-2341..3315 [-], 975Rod shape determination protein
5-3411..3578 [+], 168hypothetical protein
6-3780..4223 [+], 444hypothetical protein
7rumB4234..5406 [-], 1173Error-prone, lesion bypass DNA polymerase V (UmuC)
8tnp5690..6283 [+], 594Transposase
9tnpA7711..9477 [+], 1767Transposase
10tnpB9895..10506 [+], 612Transposase
11-10479..11627 [-], 1149hypothetical protein
12-12013..12876 [-], 864Beta-lactamase
13-12907..13038 [+], 132hypothetical protein
14-14110..15015 [+], 906DNA polymerase III
15-15103..15402 [+], 300hypothetical protein
16-15720..16643 [+], 924hypothetical protein
17-16745..19633 [+], 2889putative ATP-dependent helicase
18-19636..24606 [+], 4971Type II restriction enzyme, methylase subunits
19-24799..31221 [+], 6423Type III restriction enzyme
20-31227..33362 [+], 2136putative DNA helicaseTraI_F, T4SS component 
21traI33611..35761 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
22traD35810..37630 [+], 1821IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
23-37640..38200 [+], 561Conjugative transfer protein 234
24-38187..38822 [+], 636Conjugative transfer protein s043
25-38849..39436 [-], 588hypothetical protein
26traL39725..40006 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
27traE40015..40629 [+], 615IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
28traK40613..41509 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
29traB41512..42801 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
30traV42798..43448 [+], 651Conjugative transfer protein TraVTraV_F, T4SS component 
31traA43445..43831 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
32ynd44009..44842 [+], 834Ynd
33ync44835..45773 [+], 939Ync
34-45905..46597 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
35traC46597..48996 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
36-48989..49336 [+], 348Conjugative transfer protein 345
37trhF49320..49832 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
38traW49843..50967 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
39traU50999..51979 [+], 981IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
40traN51982..55674 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
41-55916..56164 [+], 249hypothetical protein
42-56174..58447 [+], 2274putative GTPases, GTP1/OBG family
43-58467..58985 [+], 519hypothetical protein
44dns59050..59724 [-], 675Endonuclease I precursor
45-59833..60435 [-], 603hypothetical protein
46-60672..60803 [-], 132hypothetical protein
47-60803..61129 [+], 327hypothetical protein
48ssb61145..61564 [+], 420Single-stranded DNA-binding protein
49bet61644..62462 [+], 819Recombination protein BET
50-62546..62689 [+], 144hypothetical protein
51-62750..63766 [+], 1017hypothetical protein
52-63976..64935 [+], 960Aerobic cobaltochelatase CobS subunit
53-64935..65702 [+], 768hypothetical protein
54-65801..66754 [+], 954Cobalamine biosynthesis protein
55-66816..67256 [+], 441hypothetical protein
56-67326..68981 [+], 1656Plasmid associated gene product
57-69064..69561 [+], 498DNA repair protein RadC
58-69561..69902 [+], 342hypothetical protein
59-69994..71067 [+], 1074putative primase
60-71157..71864 [+], 708hypothetical protein
61-72022..72198 [+], 177hypothetical protein
62-72372..74336 [+], 1965putative ATP-dependent endonuclease of the OLD family
63prcA74333..76225 [+], 1893ATP-dependent DNA helicase pcrA
64traF76525..77457 [+], 933IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
65traH77460..78848 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
66traG78852..82421 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
67eexS82454..82909 [-], 456EexS
68setC82943..83476 [-], 534Transcriptional activator
69setD83473..83772 [-], 300Transcriptional activator
70-83769..84317 [-], 549Soluble lytic murein transglycosylase and related regulatory proteinsOrf169_F, T4SS component 
71-84304..84966 [-], 663hypothetical protein
72-84953..85822 [-], 870hypothetical protein
73-85878..86129 [-], 252hypothetical protein
74setR86247..86894 [+], 648Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins74Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU