![]() | 1023 |
![]() ![]() | ICEPmiChn3 ![]() |
![]() | Proteus mirabilis JN28 |
![]() | 55,195 |
![]() | 50.27 |
![]() | - |
![]() | Antibiotic resistance genes: floR, sul2, aac(3)-IV, aadA2, dfrA23, ereA |
![]() | - |
![]() | KY437727 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..55195 |
![]() ![]() | coordinates: 3990..4096; oriTDB id: 200056 TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA |
![]() ![]() | - |
The graph information of ICEPmiChn3 components from KY437727 | |||||
![]() | |||||
Complete gene list of ICEPmiChn3 from KY437727 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | xis | 914..1114 [+], 201 | Xis | ||
2 | int | 1131..2372 [-], 1242 | integrase | ||
3 | - | 2374..2643 [-], 270 | unknown | ||
4 | - | 2646..3620 [-], 975 | hypothetical protein | ||
5 | rumB | 4539..5711 [-], 1173 | UV repair DNA polymerase | ||
6 | tnp | 5995..6588 [+], 594 | putative transposase | ||
7 | tnpA | 6702..9680 [+], 2979 | transposase | ||
8 | tnpB | 10098..11591 [+], 1494 | putative transposase | ||
9 | - | 11622..12506 [+], 885 | hypothetical protein | ||
10 | floR | 12723..13937 [+], 1215 | florfenicol exporter | AR | |
11 | lysR | 13965..14270 [+], 306 | hypothetical protein | ||
12 | rcr2 | 14382..15875 [+], 1494 | transposase Rcr2 | ||
13 | glmM | 16051..16353 [-], 303 | GlmM, phosphoglucosamine mutase,catalyzes the conversion of glucosamine-6-phosphate to glucosamine-1-phosphate | ||
14 | sul2 | 16440..17255 [-], 816 | dihydropteroate synthase type II | AR | |
15 | - | 17345..17914 [+], 570 | transposase | ||
16 | - | 18001..18435 [+], 435 | transposition protein | ||
17 | dmpK | 19155..19289 [-], 135 | phenol hydrolase assembly protein | ||
18 | - | 20928..21680 [+], 753 | transposase | ||
19 | hph | 22102..23127 [-], 1026 | Hph, firefly luciferase-hygromycin B phosphotransferase fusion protein, confers resistance to hygromycin | ||
20 | aac(3)-IV | 23356..24159 [-], 804 | aminoglycoside N-acetyltransferase | AR | |
21 | tnpA | 24246..24950 [+], 705 | transposase | ||
22 | intI1 | 25350..26111 [-], 762 | IntI1 | Integrase | |
23 | dfrA32 | 26269..26742 [+], 474 | dihydrofolate reductase | AR | |
24 | ereA | 26935..28155 [+], 1221 | erythromycin esterase type 1 | AR | |
25 | aadA2 | 28252..29031 [+], 780 | aminoglycoside adenyltransferase | AR | |
26 | ISPpu12 tnpA | 29211..30425 [-], 1215 | putative transposase TnpA | ||
27 | lspA | 30522..31034 [-], 513 | putative lipoprotein signal peptidase LspA | ||
28 | orf1 | 31038..31934 [-], 897 | putative cation-efflux family protein | ||
29 | orf2 | 32030..32437 [+], 408 | putative MerR family regulator | ||
30 | - | 32667..33269 [-], 603 | hypothetical protein | ||
31 | ssb | 33978..34397 [+], 420 | single-stranded DNA binding protein | ||
32 | bet | 34477..35295 [+], 819 | recombination protein, Bet | ||
33 | exo | 35582..36598 [+], 1017 | recombination related exonuclease, Exo | ||
34 | cobS | 36691..37767 [+], 1077 | aerobic cobaltochelatase CobS subunit | ||
35 | - | 37767..38534 [+], 768 | hypothetical protein | ||
36 | - | 38633..39586 [+], 954 | hypothetical protein | ||
37 | - | 39648..40088 [+], 441 | hypothetical protein | ||
38 | - | 40158..41813 [+], 1656 | hypothetical protein | ||
39 | - | 41896..42393 [+], 498 | DNA repair protein RadC | ||
40 | - | 42393..42734 [+], 342 | hypothetical protein | ||
41 | - | 42826..43899 [+], 1074 | putative primase | ||
42 | - | 43989..44693 [+], 705 | hypothetical protein | ||
43 | traF | 44798..45730 [+], 933 | TraF | TraF_F, T4SS component | |
44 | traH | 45733..47121 [+], 1389 | TraH | TraH_F, T4SS component | |
45 | traG | 47125..50694 [+], 3570 | TraG | TraG_F, T4SS component | |
46 | eexS | 50727..51182 [-], 456 | EexS | ||
47 | setC | 51216..51749 [-], 534 | transcriptional activator | ||
48 | setD | 51746..52045 [-], 300 | transcriptional activator | ||
49 | - | 52042..52590 [-], 549 | hypothetical protein | Orf169_F, T4SS component | |
50 | - | 52577..52945 [-], 369 | hypothetical protein | ||
51 | - | 53226..54095 [-], 870 | hypothetical protein | ||
52 | - | 53226..53747 [-], 522 | hypothetical protein | ||
53 | - | 54151..54402 [-], 252 | hypothetical protein | ||
54 | setR | 54520..55167 [+], 648 | transcriptional repressor | ||
55 | prfC | 55424..57013 [+], 1590 | peptide chain release factor 3 |
(1) Bie L; Wu H; Wang XH; Wang M; Xu H (2017). Identification and characterization of new members of the SXT/R391 family of integrative and conjugative elements (ICEs) in Proteus mirabilis. Int J Antimicrob Agents. 50(2):242-246. [PubMed:28602701] ![]() ![]() |
![]() |
![]() |