ICEberg
I. Information of ICE
ICEberg ID1022
Name ICEPmiCHN2416 This is a predicted ICE derived from literature
OrganismProteus mirabilis 09MAS2416
Size (bp)92,556
GC content [Genome] (%)46.71
Insertion site-
FunctionResistance to ampicillin, azithromycin, chloramphenicol, cefazolin, ciprofloxacin, gentamycin, kanamycin, STRtrimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline
Species that ICE can be transferred to-
Nucleotide SequenceKX243407 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..92556 
Putative oriT region coordinates: 3686..3792;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 34802..36952; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiCHN2416 is not available.



The graph information of ICEPmiCHN2416 components from KX243407
Complete gene list of ICEPmiCHN2416 from KX243407
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-616..810 [+], 195hypothetical protein
2int827..2068 [-], 1242integraseIntegrase 
3-2070..2339 [-], 270hypothetical protein
4-2342..3316 [-], 975Rod shape determination protein
5-3412..3579 [+], 168hypothetical protein
6-3781..4224 [+], 444hypothetical protein
7rumB4235..5407 [-], 1173Error-prone, lesion bypass DNA polymerase V (UmuC)
8tnp5691..6284 [+], 594Transposase
9tnpA6638..9478 [+], 2841Transposase
10-10376..10642 [+], 267hypothetical protein
11-11037..11162 [-], 126hypothetical protein
12-11441..12424 [+], 984hypothetical protein
13-12785..13648 [-], 864Beta-lactamase
14-13679..13810 [+], 132hypothetical protein
15-14377..14499 [+], 123hypothetical protein
16-14882..15790 [+], 909DNA polymerase III
17-15990..16289 [+], 300hypothetical protein
18-16607..17530 [+], 924hypothetical protein
19-17679..17906 [+], 228transcriptional regulator
20-17906..19960 [+], 2055Type I restriction-modification system, DNA-methyltransferase subunit M
21-19957..21252 [+], 1296conserved hypothetical protein
22-21255..21917 [+], 663hypothetical protein
23-21914..23323 [+], 1410type I restriction-modification system, S subunit, putative
24-23333..27466 [+], 4134protein kinase, putative
25-27463..29109 [+], 1647hypothetical protein
26herA33403..34638 [+], 1236Bipolar DNA helicase HerA
27traI34802..36952 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
28-37078..38181 [-], 1104putative virulence protein
29traD38315..40150 [+], 1836IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
30-40160..40720 [+], 561Conjugative transfer protein 234
31-40707..41342 [+], 636Conjugative transfer protein s043
32-41316..41435 [-], 120hypothetical protein
33fic41481..42587 [+], 1107Fic family protein
34traL42777..43058 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
35traE43055..43681 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
36traK43665..44561 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
37traB44564..45853 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
38traV45928..46500 [+], 573Conjugative transfer protein TraVTraV_F, T4SS component 
39traA46497..46883 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
40-46924..47430 [-], 507Acetyltransferase
41-47421..47687 [-], 267hypothetical protein
42-48056..48748 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
43traC48749..51148 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
44-51141..51488 [+], 348Conjugative transfer protein 345
45trhF51472..51984 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
46traW51995..53119 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
47traU53103..54131 [+], 1029IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
48traN54134..57826 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
49-58285..59703 [+], 1419hypothetical protein
50herA59700..61739 [+], 2040Bipolar DNA helicase HerA
51dns62148..62498 [-], 351Endonuclease I precursor
52-63846..64109 [-], 264Il-IS_2, transposase
53-64131..64643 [-], 513Lipoprotein signal peptidase
54-64647..65543 [-], 897Cobalt-zinc-cadmium resistance protein CzcD
55merR65639..66046 [+], 408Cd(II)/Pb(II)-responsive transcriptional regulator
56-66276..66878 [-], 603hypothetical protein
57-67009..67122 [-], 114hypothetical protein
58-67245..67571 [+], 327hypothetical protein
59ssb67587..68006 [+], 420Single-stranded DNA-binding protein
60bet68086..68904 [+], 819Recombination protein BET
61-68987..69130 [+], 144hypothetical protein
62-69191..70207 [+], 1017hypothetical protein
63-70417..71376 [+], 960Aerobic cobaltochelatase CobS subunit
64-71376..72143 [+], 768hypothetical protein
65-72242..73195 [+], 954Cobalamine biosynthesis protein
66-73257..73697 [+], 441hypothetical protein
67-73767..75422 [+], 1656Plasmid associated gene product
68-75505..76002 [+], 498DNA repair protein RadC
69-76002..76343 [+], 342hypothetical protein
70-76435..77508 [+], 1074putative primase
71-77598..78302 [+], 705hypothetical protein
72traF78395..79339 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
73traH79342..80730 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
74traG80734..84303 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
75merR84401..84790 [+], 390Mercuric resistance operon regulatory protein
76merT84875..85222 [+], 348Mercuric transport protein, MerT
77merP85282..85557 [+], 276Periplasmic mercury(+2) binding protein
78merC85567..85980 [+], 414Mercuric transport protein, MerC
79merA86018..87691 [+], 1674Dihydrolipoamide dehydrogenase
80eexR87797..88228 [-], 432EexR
81setC88283..88816 [-], 534Transcriptional activator
82setD88813..89112 [-], 300Transcriptional activator
83-89109..89657 [-], 549Soluble lytic murein transglycosylase and related regulatory proteinsOrf169_F, T4SS component 
84-89644..90306 [-], 663hypothetical protein
85-90293..91162 [-], 870hypothetical protein
86-91218..91469 [-], 252hypothetical protein
87setR91587..92234 [+], 648Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins87Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU