ICEberg
I. Information of ICE
ICEberg ID1021
Name ICEPmiCHN2410 This is a predicted ICE derived from literature
OrganismProteus mirabilis 09MAS2410
Size (bp)93,537
GC content [Genome] (%)46.45
Insertion site-
FunctionResistance to ampicillin, azithromycin, chloramphenicol, cefazolin, ciprofloxacin, kanamycin, streptomycin, trimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline
Species that ICE can be transferred to-
Nucleotide SequenceKX243406 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..93537 
Putative oriT region coordinates: 4485..4591;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 35616..37766; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiCHN2410 is not available.



The graph information of ICEPmiCHN2410 components from KX243406
Complete gene list of ICEPmiCHN2410 from KX243406
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-90..281 [-], 192hypothetical protein
2-285..446 [-], 162hypothetical protein
3-1415..1609 [+], 195hypothetical protein
4int1626..2867 [-], 1242integraseIntegrase 
5-2869..3138 [-], 270hypothetical protein
6-3141..4115 [-], 975Rod shape determination protein
7-4211..4378 [+], 168hypothetical protein
8-4580..5023 [+], 444hypothetical protein
9rumB5034..6206 [-], 1173Error-prone, lesion bypass DNA polymerase V (UmuC)
10tnp6490..7083 [+], 594Transposase
11tnpA7437..10277 [+], 2841Transposase
12-11190..11441 [+], 252hypothetical protein
13-11836..11961 [-], 126hypothetical protein
14-12240..13223 [+], 984hypothetical protein
15-13584..14447 [-], 864Beta-lactamase
16-14478..14609 [+], 132hypothetical protein
17-15176..15298 [+], 123hypothetical protein
18-15681..16589 [+], 909DNA polymerase III
19-16789..17088 [+], 300hypothetical protein
20-17406..18329 [+], 924hypothetical protein
21-18478..18705 [+], 228transcriptional regulator
22-18705..20759 [+], 2055Type I restriction-modification system, DNA-methyltransferase subunit M
23-20756..22051 [+], 1296conserved hypothetical protein
24-22054..22716 [+], 663hypothetical protein
25-22713..24122 [+], 1410type I restriction-modification system, S subunit
26-24132..28265 [+], 4134protein kinase, putative
27-28262..29908 [+], 1647hypothetical protein
28herA34217..35452 [+], 1236Bipolar DNA helicase HerA
29traI35616..37766 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
30-37892..38995 [-], 1104putative virulence protein
31traD39129..40964 [+], 1836IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
32-40998..41534 [+], 537Conjugative transfer protein 234
33-41521..42156 [+], 636Conjugative transfer protein s043
34-42130..42249 [-], 120hypothetical protein
35fic42295..43401 [+], 1107Fic family protein
36traL43591..43872 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
37traE43869..44495 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
38traK44479..45375 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
39traB45378..46667 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
40traV46664..47314 [+], 651Conjugative transfer protein TraVTraV_F, T4SS component 
41traA47311..47697 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
42-47738..48244 [-], 507Acetyltransferase
43-48235..48501 [-], 267hypothetical protein
44-48870..49562 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
45traC49563..51962 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
46-51955..52302 [+], 348Conjugative transfer protein 345
47trhF52286..52798 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
48traW52809..53933 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
49traU53965..54945 [+], 981IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
50traN54948..58640 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
51-59099..60517 [+], 1419hypothetical protein
52herA60514..62553 [+], 2040Bipolar DNA helicase HerA
53dns62962..63675 [-], 714Endonuclease I precursor
54-64961..65473 [-], 513Lipoprotein signal peptidase
55-65477..65854 [-], 378Cobalt-zinc-cadmium resistance protein CzcD
56-67258..67860 [-], 603hypothetical protein
57-68227..68553 [+], 327hypothetical protein
58ssb68569..68988 [+], 420Single-stranded DNA-binding protein
59bet69068..69886 [+], 819Recombination protein BET
60-69969..70112 [+], 144hypothetical protein
61-70173..71189 [+], 1017hypothetical protein
62-71399..72358 [+], 960Aerobic cobaltochelatase CobS subunit
63-72358..73125 [+], 768hypothetical protein
64-73224..74177 [+], 954Cobalamine biosynthesis protein
65-74239..74679 [+], 441hypothetical protein
66-74749..76404 [+], 1656Plasmid associated gene product
67-76487..76984 [+], 498DNA repair protein RadC
68-76984..77325 [+], 342hypothetical protein
69-77417..78490 [+], 1074putative primase
70-78580..79284 [+], 705hypothetical protein
71traF79377..80321 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
72traH80324..81712 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
73traG81716..85285 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
74merR85383..85772 [+], 390Mercuric resistance operon regulatory protein
75merT85857..86204 [+], 348Mercuric transport protein, MerT
76merP86264..86539 [+], 276Periplasmic mercury(+2) binding protein
77merC86549..86962 [+], 414Mercuric transport protein, MerC
78merA87000..88673 [+], 1674Dihydrolipoamide dehydrogenase
79eexR88779..89210 [-], 432EexR
80setC89265..89798 [-], 534Transcriptional activator
81setD89795..90094 [-], 300Transcriptional activator
82-90091..90639 [-], 549Soluble lytic murein transglycosylase and related regulatory proteinsOrf169_F, T4SS component 
83-90626..91288 [-], 663hypothetical protein
84-91275..92144 [-], 870hypothetical protein
85-92200..92451 [-], 252hypothetical protein
86setR92569..93216 [+], 648Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins86Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU