ICEberg
I. Information of ICE
ICEberg ID1020
Name ICEPmiCHN2407 This ICE is derived from experimental literature
ICEO ID ICEO_0000146
OrganismProteus mirabilis 09MAS2407
Size (bp)97,078
GC content [Genome] (%)47.03
Insertion site-
FunctionResistance to ampicillin, azithromycin, chloramphenicol, cefazolin, ciprofloxacin, kanamycin, streptomycin, trimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline
Species that ICE can be transferred to-
Nucleotide SequenceKX243405 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..97078 
Putative oriT region coordinates: 4485..4591;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 35651..37801; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiCHN2407 is not available.



The graph information of ICEPmiCHN2407 components from KX243405
Complete gene list of ICEPmiCHN2407 from KX243405
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-90..281 [-], 192hypothetical protein
2-285..632 [-], 348hypothetical protein
3-1415..1609 [+], 195hypothetical protein
4int1626..2867 [-], 1242integraseIntegrase 
5-2869..3138 [-], 270hypothetical protein
6-3141..4115 [-], 975Rod shape determination protein
7-4211..4378 [+], 168hypothetical protein
8-4580..5023 [+], 444hypothetical protein
9rumB5034..6137 [-], 1104Error-prone, lesion bypass DNA polymerase V (UmuC)
10tnp6490..7083 [+], 594Transposase
11tnpA7437..10277 [+], 2841Transposase
12-11190..11441 [+], 252hypothetical protein
13-11836..11961 [-], 126hypothetical protein
14-12240..13223 [+], 984hypothetical protein
15-13584..14447 [-], 864Beta-lactamase
16-14478..14609 [+], 132hypothetical protein
17-15176..15298 [+], 123hypothetical protein
18-15681..16589 [+], 909DNA polymerase III
19-16789..17088 [+], 300hypothetical protein
20-17406..18329 [+], 924hypothetical protein
21-18478..18705 [+], 228transcriptional regulator
22-18705..20759 [+], 2055Type I restriction-modification system, DNA-methyltransferase subunit M
23-20756..22051 [+], 1296conserved hypothetical protein
24-22054..22716 [+], 663hypothetical protein
25-22713..24122 [+], 1410type I restriction-modification system, S subunit, putative
26-24132..28265 [+], 4134protein kinase, putative
27-28262..29908 [+], 1647hypothetical protein
28herA34252..35487 [+], 1236Bipolar DNA helicase HerA
29traI35651..37801 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
30-37927..39030 [-], 1104putative virulence protein
31traD39164..40999 [+], 1836IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
32-41009..41569 [+], 561Conjugative transfer protein 234
33-41547..42191 [+], 645Conjugative transfer protein s043
34-42165..42284 [-], 120hypothetical protein
35fic42330..43436 [+], 1107Fic family protein
36traL43626..43907 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
37traE43904..44530 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
38traK44514..45410 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
39traB45413..46702 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
40traV46699..47349 [+], 651Conjugative transfer protein TraVTraV_F, T4SS component 
41traA47346..47732 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
42-47773..48279 [-], 507Acetyltransferase
43-48270..48536 [-], 267hypothetical protein
44-48905..49597 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
45traC49598..51997 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
46-51990..52337 [+], 348Conjugative transfer protein 345
47trhF52321..52833 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
48traW52844..53968 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
49traU53952..54980 [+], 1029IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
50traN54983..58675 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
51-59134..60552 [+], 1419hypothetical protein
52herA60549..62588 [+], 2040Bipolar DNA helicase HerA
53dns62997..63710 [-], 714Endonuclease I precursor
54-63713..64429 [-], 717Il-IS_2, transposase
55-64451..64963 [-], 513Lipoprotein signal peptidase
56-64967..65308 [-], 342Cobalt-zinc-cadmium resistance protein CzcD
57merR66211..66618 [+], 408Cd(II)/Pb(II)-responsive transcriptional regulator
58-66803..66925 [+], 123hypothetical protein
59-66937..67158 [-], 222hypothetical protein
60-67155..67433 [-], 279Resolvase
61-67699..67827 [+], 129Type IV secretory pathway, VirB4 componentsTfc16, T4SS component 
62tetA67883..69001 [-], 1119Tetracycline efflux protein TetAAR 
63-68963..69103 [+], 141hypothetical protein
64tetR69166..69825 [+], 660tetracycline repressor protein
65-70799..71401 [-], 603hypothetical protein
66-71768..72094 [+], 327hypothetical protein
67ssb72110..72529 [+], 420Single-stranded DNA-binding protein
68bet72609..73427 [+], 819Recombination protein BET
69-73510..73653 [+], 144hypothetical protein
70-73714..74730 [+], 1017hypothetical protein
71-74940..75899 [+], 960Aerobic cobaltochelatase CobS subunit
72-75899..76666 [+], 768hypothetical protein
73-76765..77718 [+], 954Cobalamine biosynthesis protein
74-77780..78220 [+], 441hypothetical protein
75-78290..79945 [+], 1656Plasmid associated gene product
76-80028..80525 [+], 498DNA repair protein RadC
77-80525..80866 [+], 342hypothetical protein
78-80958..82031 [+], 1074putative primase
79-82121..82825 [+], 705hypothetical protein
80traF82918..83862 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
81traH83865..85253 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
82traG85257..88826 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
83merR88924..89313 [+], 390Mercuric resistance operon regulatory protein
84merT89398..89745 [+], 348Mercuric transport protein, MerT
85merP89805..90080 [+], 276Periplasmic mercury(+2) binding protein
86merC90090..90503 [+], 414Mercuric transport protein, MerC
87merA90541..92214 [+], 1674Dihydrolipoamide dehydrogenase
88eexR92320..92751 [-], 432EexR
89setC92806..93339 [-], 534Transcriptional activator
90setD93336..93635 [-], 300Transcriptional activator
91-93632..94180 [-], 549Soluble lytic murein transglycosylase and related regulatory proteinsOrf169_F, T4SS component 
92-94167..94829 [-], 663hypothetical protein
93-94816..95685 [-], 870hypothetical protein
94-95741..95992 [-], 252hypothetical protein
95setR96110..96757 [+], 648Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins95Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU