ICEberg
I. Information of ICE
ICEberg ID1019
Name ICEPmiChn2 This ICE is derived from experimental literature
ICEO ID ICEO_0000148
OrganismProteus mirabilis JN7
Size (bp)104,371
GC content [Genome] (%)47.34
Insertion site-
FunctionAntibiotic resistance genes: floR, sul2
Species that ICE can be transferred toEscherichia coli J53
Nucleotide SequenceKY437726 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..104371 
Putative oriT region coordinates: 3980..4086;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 43070..45220; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiChn2 is not available.



The graph information of ICEPmiChn2 components from KY437726
Complete gene list of ICEPmiChn2 from KY437726
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1xis630..791 [+], 162Xis
2int1121..2362 [-], 1242integrase
3-2364..2633 [-], 270unknown
4-2636..3610 [-], 975hypothetical protein
5rumB4529..5701 [-], 1173UV repair DNA polymerase
6tnp5985..6578 [+], 594putative transposase
7tnpA6692..9670 [+], 2979transposase
8tnpB10088..11581 [+], 1494putative transposase
9-11612..12496 [+], 885hypothetical protein
10floR12713..13927 [+], 1215florfenicol exporterAR 
11lysR13955..14260 [+], 306hypothetical protein
12tnpA14372..15865 [+], 1494transposase
13glmM16041..16343 [-], 303phosphoglucosamine mutase
14sul216430..17245 [-], 816sulfonamide-resistance dihydropteroate synthase protein Sul2AR 
15tnpA17716..19329 [+], 1614transposase
16-19672..19941 [-], 270ultraviolet light resistance protein B
17-19949..20398 [-], 450protein UmuD
18-20517..20654 [+], 138hypothetical protein
19-21037..21942 [+], 906exonuclease, RNase T and DNA polymerase III
20-22030..22344 [+], 315conserved hypothetical protein
21-22452..23339 [+], 888conserved hypothetical protein
22-23349..23948 [+], 600conserved hypothetical protein
23-23945..24529 [+], 585conserved hypothetical protein
24-24548..28225 [+], 3678conserved hypothetical protein
25chn2-128242..30005 [+], 1764hypothetical protein
26chn2-230021..33722 [+], 3702putative restriction enzyme; adenosylmethionine-dependent methyltransferases
27chn2-333722..36379 [+], 2658putative alkaline phosphatase protein
28chn2-436396..38471 [+], 2076putative ATP-dependent Lon protease; turnover of interacellular proteins function
29chn2-538622..42914 [+], 4293hypothetical protein
30traI43070..45220 [+], 2151TraIRelaxase, MOBH Family
31traD45269..47089 [+], 1821TraDTraD_F, T4SS component 
32-47099..47659 [+], 561hypothetical protein
33-47646..48281 [+], 636conjugative transfer protein s043
34enispa1-148353..48979 [+], 627hypothetical protein
35enispa1-249192..50091 [+], 900putative Zn peptidase
36traL50228..50509 [+], 282TraLTraL_F, T4SS component 
37traE50740..51132 [+], 393TraETraE_F, T4SS component 
38traK51113..52012 [+], 900TraKTraK_F, T4SS component 
39traB52015..53304 [+], 1290TraBTraB_F, T4SS component 
40htdD53301..53951 [+], 651HtdDTraV_F, T4SS component 
41traA53948..54334 [+], 387TraATraA_F, T4SS component 
42ynd54513..55346 [+], 834Ynd
43ync55339..56277 [+], 939Ync
44dsbC56409..57101 [+], 693thiol:disulfide interchange protein DsbCTrbB_I, T4SS component 
45traC57101..59500 [+], 2400TraCTraC_F, T4SS component 
46trbI59824..60336 [+], 513TrbITraF, T4SS component 
47traW60347..61471 [+], 1125TraWTraW_F, T4SS component 
48traU61455..62483 [+], 1029TraUTraU_F, T4SS component 
49traN62486..66178 [+], 3693TraNTraN_F, T4SS component 
50chn166637..68055 [+], 1419hypothetical protein
51chn268052..70091 [+], 2040hypothetical protein
52ISPpu12 tnpA71216..72430 [-], 1215putative transposase TnpA
53lspA72529..73041 [-], 513putative lipoprotein signal peptidase LspA
54orf173045..73941 [-], 897putative cation-efflux family protein
55orf274037..74444 [+], 408putative MerR family regulator
56-74674..75276 [-], 603hypothetical protein
57ssb75986..76405 [+], 420single-stranded DNA binding protein
58bet76485..77303 [+], 819recombination protein, Bet
59exo77591..78607 [+], 1017recombination related exonuclease, Exo
60cobS78700..79776 [+], 1077aerobic cobaltochelatase CobS subunit
61-79776..80543 [+], 768hypothetical protein
62-80642..81595 [+], 954hypothetical protein
63-81657..82097 [+], 441hypothetical protein
64-82167..83822 [+], 1656hypothetical protein
65-83906..84403 [+], 498DNA repair protein RadC
66-84403..84744 [+], 342hypothetical protein
67-84836..85909 [+], 1074putative primase
68-85999..86703 [+], 705hypothetical protein
69chn2-686904..91820 [+], 4917unknown
70chn2-791783..92634 [-], 852unknownIntegrase 
71chn2-892827..93825 [+], 999unknown
72traF93964..94896 [+], 933TraFTraF_F, T4SS component 
73traH94899..96287 [+], 1389TraHTraH_F, T4SS component 
74traG96291..99860 [+], 3570TraGTraG_F, T4SS component 
75eexS99893..100348 [-], 456EexS
76setC100382..100915 [-], 534transcriptional activator
77setD100912..101211 [-], 300transcriptional activator
78-101208..101756 [-], 549hypothetical proteinOrf169_F, T4SS component 
79-101743..102111 [-], 369hypothetical protein
80-102392..103261 [-], 870hypothetical protein
81-102392..102913 [-], 522hypothetical protein
82-103317..103568 [-], 252hypothetical protein
83setR103686..104333 [+], 648transcriptional repressor
84prfC104590..106179 [+], 1590peptide chain release factor 3
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins83Fasta
(1) Bie L; Wu H; Wang XH; Wang M; Xu H (2017). Identification and characterization of new members of the SXT/R391 family of integrative and conjugative elements (ICEs) in Proteus mirabilis. Int J Antimicrob Agents. 50(2):242-246. [PubMed:28602701] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU