ICEberg
I. Information of ICE
ICEberg ID1018
Name ICEPmiCHN1809 This ICE is derived from experimental literature
ICEO ID ICEO_0000149
OrganismProteus mirabilis TJ1809
Size (bp)76,218
GC content [Genome] (%)47.11
Insertion site-
FunctionResistance to ampicillin, azithromycin, chloramphenicol, ciprofloxacin, kanamycin, trimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline
Species that ICE can be transferred to-
Nucleotide SequenceKX243413 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..76218 
Putative oriT region coordinates: 4064..4170;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 21095..23245; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiCHN1809 is not available.



The graph information of ICEPmiCHN1809 components from KX243413
Complete gene list of ICEPmiCHN1809 from KX243413
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1-472..666 [+], 195hypothetical protein
2-718..930 [-], 213hypothetical protein
3int1205..2446 [-], 1242integrase
4-2448..2717 [-], 270hypothetical protein
5-2720..3694 [-], 975Rod shape determination protein
6-3790..3957 [+], 168hypothetical protein
7-4159..4602 [+], 444hypothetical protein
8rumB4613..5881 [-], 1269Error-prone, lesion bypass DNA polymerase V (UmuC)
9rumA5889..6338 [-], 450Error-prone repair protein UmuD
10-6936..8204 [+], 1269transposase,IS4
11-8387..9295 [+], 909DNA polymerase III
12-9369..9668 [+], 300hypothetical protein
13-9740..9949 [+], 210hypothetical protein
14-9933..13058 [+], 3126hypothetical protein
15-13104..14186 [+], 1083hypothetical protein
16-14306..17308 [+], 3003Adenine-specific DNA methylase containing a Zn-ribbon
17-17384..20134 [+], 2751putative DEAH ATP-dependent helicase
18-20131..21000 [+], 870Mrr restriction endonuclease
19traI21095..23245 [+], 2151Conjugative transfer protein TraI, relaxaseRelaxase, MOBH Family
20traD23294..25114 [+], 1821IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
21-25124..25684 [+], 561Conjugative transfer protein 234
22-25671..26306 [+], 636Conjugative transfer protein s043
23-26333..26920 [-], 588hypothetical protein
24traL27209..27490 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
25traE27487..28113 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
26traK28097..28993 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
27traB28996..30285 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
28traV30360..30932 [+], 573Conjugative transfer protein TraVTraV_F, T4SS component 
29traA30929..31315 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
30-31396..32334 [-], 939TIORF34 protein
31-32676..33368 [+], 693Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
32traC33368..35767 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
33-35760..36107 [+], 348Conjugative transfer protein 345
34trhF36091..36603 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
35traW36614..37738 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
36traU37770..38750 [+], 981IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
37traN38753..42445 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
38-42755..43645 [+], 891putative integraseIntegrase 
39-43642..44694 [+], 1053transposase
40-45061..50835 [+], 5775serine protease-like
41-50959..51561 [-], 603hypothetical protein
42-51929..52255 [+], 327hypothetical protein
43ssb52271..52690 [+], 420Single-stranded DNA-binding protein
44bet52770..53588 [+], 819Recombination protein BET
45-53671..53814 [+], 144hypothetical protein
46-53875..54891 [+], 1017hypothetical protein
47-55101..56060 [+], 960Aerobic cobaltochelatase CobS subunit
48-56060..56827 [+], 768hypothetical protein
49-56926..57879 [+], 954Cobalamine biosynthesis protein
50-57941..58381 [+], 441hypothetical protein
51-58451..60100 [+], 1650Plasmid associated gene product
52-60184..60681 [+], 498DNA repair protein RadC
53-60681..61022 [+], 342hypothetical protein
54-61114..62187 [+], 1074putative primase
55-62423..63130 [+], 708hypothetical protein
56-63183..65291 [+], 2109Translation-disabling ACNase RloC
57traF65521..66465 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
58traH66468..67856 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
59traG67860..71429 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
60eexR71460..71891 [-], 432EexR
61setC71946..72479 [-], 534Transcriptional activator
62setD72476..72775 [-], 300Transcriptional activator
63-72772..73320 [-], 549Soluble lytic murein transglycosylase and related regulatory proteinsOrf169_F, T4SS component 
64-73307..73969 [-], 663hypothetical protein
65-73956..74825 [-], 870hypothetical protein
66-74881..75132 [-], 252hypothetical protein
67setR75250..75897 [+], 648Putative cI prophage repressor protein
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins67Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU