 ICEberg ID | 1017 |
Name  | ICEPmiCHN1586  |
| ICEO ID | ICEO_0000145 |
| Organism | Proteus mirabilis 08MAS1586 |
| Size (bp) | 99,355 |
| GC content [Genome] (%) | 46.98 |
| Insertion site | - |
| Function | Resistance to ampicillin, azithromycin, chloramphenicol, ciprofloxacin, ampicillin-sulbactam, streptomycin, trimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline |
| Species that ICE can be transferred to | - |
| Nucleotide Sequence | KX243404 (complete ICE sequence in this GenBank file) |
| Replicon | - |
| Coordinates | 1..99355 |
| Putative oriT region | coordinates: 5884..5990; oriTDB id: 200056 TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA |
| Putative relaxase | - |
The graph information of ICEPmiCHN1586 components from KX243404 | |||||
 | |||||
| Complete gene list of ICEPmiCHN1586 from KX243404 | |||||
| # | Gene | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation | |
| 1 | - | 472..660 [+], 189 | hypothetical protein | ||
| 2 | mutL | 1279..2895 [+], 1617 | DNA mismatch repair protein MutL | ||
| 3 | int | 3025..4266 [-], 1242 | integrase | Integrase | |
| 4 | - | 4268..4537 [-], 270 | hypothetical protein | ||
| 5 | - | 4540..5514 [-], 975 | hypothetical protein | ||
| 6 | - | 5589..5777 [+], 189 | hypothetical protein | ||
| 7 | - | 5979..6422 [+], 444 | hypothetical protein | ||
| 8 | rumB | 6433..7536 [-], 1104 | Error-prone, lesion bypass DNA polymerase V (UmuC) | ||
| 9 | tnp | 7889..8482 [+], 594 | Transposase | ||
| 10 | tnpA | 8596..11574 [+], 2979 | Transposase | ||
| 11 | tnpB | 11992..13485 [+], 1494 | Transposase | ||
| 12 | - | 13721..13840 [+], 120 | hypothetical protein | ||
| 13 | dhfR | 13837..14343 [+], 507 | Dihydrofolate reductase | ||
| 14 | - | 15954..16718 [+], 765 | hypothetical protein | ||
| 15 | floR | 16935..18149 [+], 1215 | Bicyclomycin resistance protein | AR | |
| 16 | - | 18177..18482 [+], 306 | LysR family transcriptional regulator | ||
| 17 | tnpB | 18594..19133 [+], 540 | Transposase | ||
| 18 | strB | 19105..19941 [-], 837 | streptomycin phosphotransferase | AR | |
| 19 | strA | 19941..20507 [-], 567 | streptomycin phosphotransferase | ||
| 20 | sul2 | 20805..21620 [-], 816 | Dihydropteroate synthase | AR | |
| 21 | tnpA | 22091..23704 [+], 1614 | Transposase | ||
| 22 | rumB | 24047..24316 [-], 270 | Error-prone, lesion bypass DNA polymerase V (UmuC) | ||
| 23 | rumA | 24324..24773 [-], 450 | Error-prone repair protein UmuD | ||
| 24 | - | 24772..25029 [+], 258 | hypothetical protein | ||
| 25 | - | 25412..26317 [+], 906 | DNA polymerase III | ||
| 26 | - | 26405..26704 [+], 300 | hypothetical protein | ||
| 27 | - | 27022..27945 [+], 924 | hypothetical protein | ||
| 28 | - | 28047..30935 [+], 2889 | putative ATP-dependent helicase | ||
| 29 | - | 32626..35970 [+], 3345 | Type II restriction enzyme, methylase subunits | ||
| 30 | - | 36163..42585 [+], 6423 | Helicase | ||
| 31 | - | 42591..44726 [+], 2136 | putative DNA helicase | TraI_F, T4SS component | |
| 32 | traI | 46958..47197 [+], 240 | Conjugative transfer protein TraI, relaxase | ||
| 33 | traD | 47246..49066 [+], 1821 | IncF plasmid conjugative transfer protein TraD | TraD_F, T4SS component | |
| 34 | - | 49076..49636 [+], 561 | Conjugative transfer protein 234 | ||
| 35 | - | 49623..50258 [+], 636 | Conjugative transfer protein s043 | ||
| 36 | - | 50285..50872 [-], 588 | hypothetical protein | ||
| 37 | traL | 51161..51442 [+], 282 | IncF plasmid conjugative transfer pilus assembly protein TraL | TraL_F, T4SS component | |
| 38 | traE | 51439..52065 [+], 627 | IncF plasmid conjugative transfer pilus assembly protein TraE | TraE_F, T4SS component | |
| 39 | traK | 52049..52945 [+], 897 | IncF plasmid conjugative transfer pilus assembly protein TraK | TraK_F, T4SS component | |
| 40 | traB | 52948..54237 [+], 1290 | IncF plasmid conjugative transfer pilus assembly protein TraB | TraB_F, T4SS component | |
| 41 | traV | 54312..54884 [+], 573 | Conjugative transfer protein TraV | TraV_F, T4SS component | |
| 42 | traA | 54881..55267 [+], 387 | Conjugative transfer protein TraA | TraA_F, T4SS component | |
| 43 | ynd | 55445..56278 [+], 834 | Ynd | ||
| 44 | ync | 56271..57209 [+], 939 | Ync | ||
| 45 | - | 57708..58112 [+], 405 | Thiol:disulfide involved in conjugative transfer | TrbB_I, T4SS component | |
| 46 | traC | 58112..60511 [+], 2400 | IncF plasmid conjugative transfer pilus assembly protein TraC | TraC_F, T4SS component | |
| 47 | - | 60504..60851 [+], 348 | Conjugative transfer protein 345 | ||
| 48 | trhF | 60835..61347 [+], 513 | Conjugative signal peptidase TrhF | TraF, T4SS component | |
| 49 | traW | 61358..62482 [+], 1125 | IncF plasmid conjugative transfer pilus assembly protein TraW | TraW_F, T4SS component | |
| 50 | traU | 62514..63494 [+], 981 | IncF plasmid conjugative transfer pilus assembly protein TraU | TraU_F, T4SS component | |
| 51 | traN | 65336..67402 [+], 2067 | IncF plasmid conjugative transfer protein TraN | TraN_F, T4SS component | |
| 52 | - | 67644..67892 [+], 249 | hypothetical protein | ||
| 53 | - | 68777..70258 [+], 1482 | putative GTPases, GTP1/OBG family | ||
| 54 | - | 70278..70796 [+], 519 | hypothetical protein | ||
| 55 | dns | 70861..71202 [-], 342 | Endonuclease I precursor | ||
| 56 | - | 71717..72319 [-], 603 | hypothetical protein | ||
| 57 | - | 72556..72687 [-], 132 | hypothetical protein | ||
| 58 | ssb | 73095..73514 [+], 420 | Single-stranded DNA-binding protein | ||
| 59 | bet | 73594..74412 [+], 819 | Recombination protein BET | ||
| 60 | - | 74496..74639 [+], 144 | hypothetical protein | ||
| 61 | - | 74794..75810 [+], 1017 | hypothetical protein | ||
| 62 | - | 76020..76979 [+], 960 | Aerobic cobaltochelatase CobS subunit | ||
| 63 | - | 76979..77746 [+], 768 | hypothetical protein | ||
| 64 | - | 77845..78798 [+], 954 | Cobalamine biosynthesis protein | ||
| 65 | - | 78860..79300 [+], 441 | hypothetical protein | ||
| 66 | - | 79370..81025 [+], 1656 | Plasmid associated gene product | ||
| 67 | - | 81109..81606 [+], 498 | DNA repair protein RadC | ||
| 68 | - | 81606..81947 [+], 342 | hypothetical protein | ||
| 69 | - | 82365..83207 [+], 843 | putative primase | ||
| 70 | - | 83297..84004 [+], 708 | hypothetical protein | ||
| 71 | - | 84165..84338 [+], 174 | hypothetical protein | ||
| 72 | - | 84512..86476 [+], 1965 | putative ATP-dependent endonuclease of the OLD family | ||
| 73 | prcA | 86473..88365 [+], 1893 | ATP-dependent DNA helicase pcrA | ||
| 74 | traF | 88653..89597 [+], 945 | IncF plasmid conjugative transfer pilus assembly protein TraF | TraF_F, T4SS component | |
| 75 | traH | 89600..90988 [+], 1389 | IncF plasmid conjugative transfer pilus assembly protein TraH | TraH_F, T4SS component | |
| 76 | traG | 90992..94561 [+], 3570 | IncF plasmid conjugative transfer protein TraG | TraG_F, T4SS component | |
| 77 | eexS | 94594..95049 [-], 456 | EexS | ||
| 78 | setC | 95083..95616 [-], 534 | Transcriptional activator | ||
| 79 | setD | 95613..95912 [-], 300 | Transcriptional activator | ||
| 80 | - | 95909..96457 [-], 549 | Soluble lytic murein transglycosylase and related regulatory proteins | Orf169_F, T4SS component | |
| 81 | - | 96444..97106 [-], 663 | hypothetical protein | ||
| 82 | - | 97093..97962 [-], 870 | hypothetical protein | ||
| 83 | - | 98018..98269 [-], 252 | hypothetical protein | ||
| 84 | setR | 98387..99034 [+], 648 | Putative cI prophage repressor protein | ||
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PubMed:27892525] 
|
| experimental literature |
| in silico analysis literature |