ICEberg
I. Information of ICE
ICEberg ID1016
Name ICEPmiChn1 This ICE is derived from experimental literature
ICEO ID ICEO_0000018
OrganismProteus mirabilis
Size (bp)92751
GC content [Genome] (%)48.01
Insertion siteprfC
FunctionAntibiotic resistance genes: floR, tet(G), strAB and sul2; doxycycline, streptomycin, spectinomycin, trimethoprim-sulfamethoxazole, florfenicol resistance
Species that ICE can be transferred toEscherichia coli
Nucleotide SequenceKT962845 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..92751 
Putative oriT region coordinates: 3990..4096;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 38622..40772; Gene: traI;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiChn1 is not available.



The graph information of ICEPmiChn1 components from KT962845
Complete gene list of ICEPmiChn1 from KT962845
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)		 *Reannotation 
1xis914..1114 [+], 201Xis
2int1131..2372 [-], 1242integrase
3-2374..2643 [-], 270S002
4-2646..3620 [-], 975hypothetical protein
5rumB4539..5711 [-], 1173UV repair DNA polymerase
6tnp5995..6588 [+], 594putative transposase
7tnpA6702..9680 [+], 2979transposase
8tnpB10098..11591 [+], 1494putative transposase
9-11622..12506 [+], 885hypothetical protein
10floR12723..13937 [+], 1215florfenicol exporterAR 
11lysR13965..14270 [+], 306hypothetical protein
12tetA14537..15811 [-], 1275tetracycline repressor protein TetAAR 
13tetR15815..16492 [+], 678tetracycline resistance repressor protein TetR
14strB17072..17677 [-], 606streptomycin phosphotransferase protein StrBAR 
15strA17908..18525 [-], 618streptomycin phosphotransferase protein StrA
16sul218772..19587 [-], 816sulfonamide-resistance dihydropteroate synthase protein Sul2AR 
17tnpI19960..20250 [+], 291TnpI transposase
18tnpII20382..21113 [+], 732TnpII transposaseIntegrase 
19-21124..22101 [-], 978hypothetical protein
20rumB22308..22616 [-], 309RumB
21rumA22585..23034 [-], 450hypothetical protein
22-23676..24581 [+], 906hypothetical protein
23-24669..24968 [+], 300hypothetical protein
24-25286..26239 [+], 954hypothetical protein
25-26320..28155 [+], 1836RM system Met subunit
26-28157..30808 [+], 2652RM system Res subunit
27-30905..34786 [+], 3882hypothetical protein
28-34741..37212 [+], 2472hypothetical protein
29-37284..38465 [+], 1182hypothetical protein
30traI38622..40772 [+], 2151TraIRelaxase, MOBH Family
31traD40821..42641 [+], 1821TraDTraD_F, T4SS component 
32-42651..43211 [+], 561hypothetical protein
33-43198..43833 [+], 636Conjugative transfer protein s043
34enispa1-143905..44531 [+], 627hypothetical protein
35enispa1-244743..45642 [+], 900putative Zn peptidase
36traL45779..46060 [+], 282TraLTraL_F, T4SS component 
37traE46291..46683 [+], 393TraETraE_F, T4SS component 
38traK46664..47563 [+], 900TraKTraK_F, T4SS component 
39traB47566..48855 [+], 1290TraBTraB_F, T4SS component 
40htdD48852..49502 [+], 651HtdDTraV_F, T4SS component 
41traA49499..49885 [+], 387TraATraA_F, T4SS component 
42ynd50064..50897 [+], 834Ynd
43ync50890..51828 [+], 939Ync
44dsbC51960..52652 [+], 693thiol:disulfide interchange protein DsbCTrbB_I, T4SS component 
45traC52652..55051 [+], 2400TraCTraC_F, T4SS component 
46trbI55375..55887 [+], 513TrbITraF, T4SS component 
47traW55898..57022 [+], 1125TraWTraW_F, T4SS component 
48traU57006..58034 [+], 1029TraUTraU_F, T4SS component 
49traN58037..61729 [+], 3693TraNTraN_F, T4SS component 
50-62188..63606 [+], 1419hypothetical protein
51-63603..65642 [+], 2040hypothetical protein
52ISPpu12 tnpA66767..67981 [-], 1215putative transposase TnpA
53lspA68078..68590 [-], 513putative lipoprotein signal peptidase LspA
54cation-efflux family gene68594..69490 [-], 897putative cation-efflux family protein
55putative MerR family gene69586..69993 [+], 408putative MerR family regulator
56-70223..70825 [-], 603Hypothetical protein
57ssb71534..71953 [+], 420single-stranded DNA binding protein
58bet72033..72851 [+], 819Recombination protein, Bet
59exo73138..74154 [+], 1017Recombination related exonuclease, Exo
60cobS74247..75323 [+], 1077Aerobic cobaltochelatase CobS subunit
61-75323..76090 [+], 768hypothetical protein
62-76189..77142 [+], 954hypothetical protein
63-77204..77644 [+], 441hypothetical protein
64-77714..79369 [+], 1656hypothetical protein
65-79452..79949 [+], 498DNA repair protein RadC
66-79949..80290 [+], 342hypothetical protein
67-80382..81455 [+], 1074putative primase
68-81545..82249 [+], 705hypothetical protein
69traF82354..83286 [+], 933TraFTraF_F, T4SS component 
70traH83289..84677 [+], 1389TraHTraH_F, T4SS component 
71traG84681..88250 [+], 3570TraGTraG_F, T4SS component 
72eexS88283..88738 [-], 456EexS
73setC88772..89305 [-], 534transcriptional activator
74setD89302..89601 [-], 300transcriptional activator
75-89598..90146 [-], 549hypothetical proteinOrf169_F, T4SS component 
76-90133..90501 [-], 369hypothetical protein
77-90782..91651 [-], 870hypothetical protein
78-90782..91303 [-], 522hypothetical protein
79-91707..91958 [-], 252hypothetical protein
80setR92076..92723 [+], 648transcriptional repressor
81prfC92980..94569 [+], 1590peptide chain release factor 3
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins80Fasta
(1) Ryan MP; Armshaw P; O'Halloran JA; Pembroke JT (2017). Analysis and comparative genomics of R997, the first SXT/R391 integrative and conjugative element (ICE) of the Indian Sub-Continent. Sci Rep. 7(1):8562. [PubMed:28819148]
(2) Badhai J; Das SK (2016). Characterization of Three Novel SXT/R391 Integrating Conjugative Elements ICEMfuInd1a and ICEMfuInd1b, and ICEMprChn1 Identified in the Genomes of Marinomonas fungiae JCM 18476(T) and Marinomonas profundimaris Strain D104. Front Microbiol. 1.608333333. [PubMed:27933056] experimental in_silico
(3) Lei CW; Zhang AY; Wang HN; Liu BH; Yang LQ; Yang YQ (2016). Characterization of SXT/R391 Integrative and Conjugative Elements in Proteus mirabilis Isolates from Food-Producing Animals in China. Antimicrob Agents Chemother. 60(3):1935-8. [PubMed:26824957] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature

Genomics & Bioinformatics Group in MML, SJTU