Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 4202764..4202904 | Replicon | chromosome |
Accession | NZ_CP027539 | ||
Organism | Serratia marcescens strain AR_0099 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 4202764..4202860 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 4202764..4202904 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM478_RS19860 | 4198337..4198672 | - | 336 | WP_033638120.1 | hypothetical protein | - |
AM478_RS19865 | 4198716..4199021 | - | 306 | WP_033646422.1 | hypothetical protein | - |
AM478_RS19870 | 4199193..4199411 | - | 219 | WP_033646423.1 | hypothetical protein | - |
AM478_RS19875 | 4199639..4200838 | - | 1200 | WP_033638117.1 | trans-2-enoyl-CoA reductase family protein | - |
AM478_RS19880 | 4201022..4201372 | - | 351 | WP_033638116.1 | DUF4377 domain-containing protein | - |
AM478_RS25405 | 4201664..4201828 | + | 165 | WP_154067227.1 | hypothetical protein | - |
AM478_RS19885 | 4201892..4202110 | + | 219 | WP_033638114.1 | hypothetical protein | - |
AM478_RS19890 | 4202107..4202511 | - | 405 | WP_033646424.1 | hypothetical protein | - |
- | 4202764..4202860 | - | 97 | - | - | Toxin |
- | 4202764..4202904 | + | 141 | - | - | Antitoxin |
AM478_RS19895 | 4203002..4203343 | - | 342 | WP_025302452.1 | YebY family protein | - |
AM478_RS19900 | 4203413..4204294 | - | 882 | WP_033646425.1 | copper homeostasis membrane protein CopD | - |
AM478_RS19905 | 4204297..4204713 | - | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
AM478_RS19910 | 4205007..4205525 | - | 519 | WP_025302449.1 | non-heme ferritin | - |
AM478_RS19915 | 4205871..4206101 | + | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
AM478_RS19920 | 4206133..4207086 | - | 954 | WP_033646426.1 | prolyl aminopeptidase | - |
AM478_RS19925 | 4207279..4207704 | - | 426 | WP_033638066.1 | RNA polymerase-binding protein DksA | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T99253 NZ_CP027539:c4202860-4202764 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT99253 NZ_CP027539:4202764-4202904 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG