Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1640410..1640550 | Replicon | chromosome |
Accession | NZ_CP027533 | ||
Organism | Serratia marcescens strain AR_0091 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1640454..1640550 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1640410..1640550 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM470_RS08060 | 1635612..1636037 | + | 426 | WP_033653830.1 | RNA polymerase-binding protein DksA | - |
AM470_RS08065 | 1636230..1637183 | + | 954 | WP_033646426.1 | prolyl aminopeptidase | - |
AM470_RS08070 | 1637215..1637445 | - | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
AM470_RS08075 | 1637791..1638309 | + | 519 | WP_025302449.1 | non-heme ferritin | - |
AM470_RS08080 | 1638634..1639017 | + | 384 | WP_004940886.1 | CopC domain-containing protein YobA | - |
AM470_RS08085 | 1639020..1639901 | + | 882 | WP_060428500.1 | copper homeostasis membrane protein CopD | - |
AM470_RS08090 | 1639971..1640312 | + | 342 | WP_025302452.1 | YebY family protein | - |
- | 1640410..1640550 | - | 141 | - | - | Antitoxin |
- | 1640454..1640550 | + | 97 | - | - | Toxin |
AM470_RS08095 | 1640803..1641207 | + | 405 | WP_033646424.1 | hypothetical protein | - |
AM470_RS08100 | 1641204..1641422 | - | 219 | WP_033638114.1 | hypothetical protein | - |
AM470_RS25485 | 1641496..1641645 | - | 150 | WP_154619228.1 | hypothetical protein | - |
AM470_RS08105 | 1641937..1642287 | + | 351 | WP_060428502.1 | DUF4377 domain-containing protein | - |
AM470_RS08110 | 1642471..1643670 | + | 1200 | WP_033638117.1 | trans-2-enoyl-CoA reductase family protein | - |
AM470_RS08115 | 1643898..1644116 | + | 219 | WP_033646423.1 | hypothetical protein | - |
AM470_RS08120 | 1644288..1644593 | + | 306 | WP_033646422.1 | hypothetical protein | - |
AM470_RS08125 | 1644637..1644972 | + | 336 | WP_033638120.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T99173 NZ_CP027533:1640454-1640550 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT99173 NZ_CP027533:c1640550-1640410 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG