Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 596956..597043 | Replicon | chromosome |
Accession | NZ_CP027397 | ||
Organism | Yersinia intermedia strain FDAARGOS_358 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 596956..597039 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 596956..597043 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CEQ36_RS02605 | 592537..593493 | + | 957 | WP_032905818.1 | prolyl aminopeptidase | - |
CEQ36_RS02610 | 593547..593777 | - | 231 | WP_005183015.1 | DNA polymerase III subunit theta | - |
CEQ36_RS02615 | 594168..594671 | + | 504 | WP_005183013.1 | non-heme ferritin | - |
CEQ36_RS02620 | 595060..595446 | + | 387 | WP_005183010.1 | CopC domain-containing protein YobA | - |
CEQ36_RS02625 | 595448..596332 | + | 885 | WP_050297378.1 | copper homeostasis membrane protein CopD | - |
CEQ36_RS02630 | 596429..596770 | + | 342 | WP_005183006.1 | YebY family protein | - |
- | 596956..597039 | + | 84 | - | - | Toxin |
- | 596956..597043 | - | 88 | - | - | Antitoxin |
CEQ36_RS02635 | 597118..598200 | - | 1083 | WP_080608185.1 | phage integrase Arm DNA-binding domain-containing protein | - |
CEQ36_RS02640 | 598175..598441 | - | 267 | WP_025378521.1 | excisionase | - |
CEQ36_RS02645 | 598514..599026 | - | 513 | WP_080608186.1 | siphovirus Gp157 family protein | - |
CEQ36_RS02650 | 599023..601116 | - | 2094 | WP_080608187.1 | hypothetical protein | - |
CEQ36_RS02655 | 601193..601507 | - | 315 | WP_125461923.1 | hypothetical protein | - |
CEQ36_RS02660 | 601606..601836 | - | 231 | WP_080608189.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 596429..652777 | 56348 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 84 bp
>T98629 NZ_CP027397:596956-597039 [Yersinia intermedia]
ATTAATGCCAACTTTTAGCGCACGGCTCTGTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTATTCGGTCTTT
TTTT
ATTAATGCCAACTTTTAGCGCACGGCTCTGTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTATTCGGTCTTT
TTTT
Antitoxin
Download Length: 88 bp
>AT98629 NZ_CP027397:c597043-596956 [Yersinia intermedia]
AGATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGACAGAGCCGTGCGCTAAAAGTTG
GCATTAAT
AGATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGACAGAGCCGTGCGCTAAAAGTTG
GCATTAAT