Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1998427..1998567 | Replicon | chromosome |
Accession | NZ_CP027300 | ||
Organism | Serratia marcescens strain SGAir0764 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1998471..1998567 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1998427..1998567 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
C1N78_RS09635 | 1993695..1994090 | + | 396 | WP_048322942.1 | RidA family protein | - |
C1N78_RS09640 | 1994247..1995200 | + | 954 | WP_063919601.1 | prolyl aminopeptidase | - |
C1N78_RS09645 | 1995232..1995462 | - | 231 | WP_016928156.1 | DNA polymerase III subunit theta | - |
C1N78_RS09650 | 1995807..1996325 | + | 519 | WP_015377481.1 | non-heme ferritin | - |
C1N78_RS09655 | 1996618..1997034 | + | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
C1N78_RS09660 | 1997037..1997918 | + | 882 | WP_048797011.1 | copper homeostasis membrane protein CopD | - |
C1N78_RS09665 | 1997988..1998329 | + | 342 | WP_016928154.1 | YebY family protein | - |
- | 1998427..1998567 | - | 141 | - | - | Antitoxin |
- | 1998471..1998567 | + | 97 | - | - | Toxin |
C1N78_RS09670 | 1998819..1999223 | + | 405 | WP_110146888.1 | hypothetical protein | - |
C1N78_RS09675 | 1999220..1999438 | - | 219 | WP_110146889.1 | hypothetical protein | - |
C1N78_RS09680 | 1999513..1999857 | - | 345 | WP_110146890.1 | hypothetical protein | - |
C1N78_RS09685 | 2000106..2000456 | + | 351 | WP_033640658.1 | DUF4377 domain-containing protein | - |
C1N78_RS09690 | 2000640..2001839 | + | 1200 | WP_004940952.1 | trans-2-enoyl-CoA reductase family protein | - |
C1N78_RS09695 | 2002066..2002284 | + | 219 | WP_033640657.1 | hypothetical protein | - |
C1N78_RS09700 | 2002456..2002761 | + | 306 | WP_004940954.1 | hypothetical protein | - |
C1N78_RS09705 | 2002810..2003145 | + | 336 | WP_016928131.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T97783 NZ_CP027300:1998471-1998567 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT97783 NZ_CP027300:c1998567-1998427 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG