Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 5205670..5205815 | Replicon | chromosome |
Accession | NZ_CP026751 | ||
Organism | Klebsiella pneumoniae strain AR_0066 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 5205706..5205808 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 5205670..5205815 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM445_RS26010 | 5200800..5202860 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
AM445_RS26015 | 5202864..5203523 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
AM445_RS26020 | 5203602..5203832 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
AM445_RS26025 | 5203945..5204319 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
AM445_RS26030 | 5204323..5205192 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
AM445_RS26035 | 5205209..5205547 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 5205670..5205815 | - | 146 | - | - | Antitoxin |
- | 5205706..5205808 | + | 103 | - | - | Toxin |
AM445_RS29130 | 5206184..5206327 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
AM445_RS26045 | 5206432..5207400 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
AM445_RS26050 | 5207557..5208210 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
AM445_RS26055 | 5208207..5208398 | - | 192 | WP_002911395.1 | YebW family protein | - |
AM445_RS26060 | 5208496..5208735 | - | 240 | WP_002911393.1 | YebV family protein | - |
AM445_RS26065 | 5208851..5210284 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 5132616..5218886 | 86270 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T95627 NZ_CP026751:5205706-5205808 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT95627 NZ_CP026751:c5205815-5205670 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT