Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 974936..975076 | Replicon | chromosome |
Accession | NZ_CP026702 | ||
Organism | Serratia marcescens strain AR_0027 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 974936..975032 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 974936..975076 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AM354_RS04565 | 970519..970854 | - | 336 | WP_049235095.1 | hypothetical protein | - |
AM354_RS04570 | 970898..971203 | - | 306 | WP_033646422.1 | hypothetical protein | - |
AM354_RS04575 | 971375..971593 | - | 219 | WP_033646423.1 | hypothetical protein | - |
AM354_RS04580 | 971821..973020 | - | 1200 | WP_033638117.1 | trans-2-enoyl-CoA reductase family protein | - |
AM354_RS04585 | 973204..973554 | - | 351 | WP_033638116.1 | DUF4377 domain-containing protein | - |
AM354_RS26350 | 973847..974011 | + | 165 | WP_154609290.1 | hypothetical protein | - |
AM354_RS04590 | 974075..974293 | + | 219 | WP_004940942.1 | hypothetical protein | - |
AM354_RS04595 | 974290..974694 | - | 405 | WP_049235094.1 | hypothetical protein | - |
- | 974936..975032 | - | 97 | - | - | Toxin |
- | 974936..975076 | + | 141 | - | - | Antitoxin |
AM354_RS04600 | 975174..975515 | - | 342 | WP_025302452.1 | YebY family protein | - |
AM354_RS04605 | 975585..976466 | - | 882 | WP_049234570.1 | copper homeostasis membrane protein CopD | - |
AM354_RS04610 | 976469..976852 | - | 384 | WP_004940886.1 | CopC domain-containing protein YobA | - |
AM354_RS04615 | 977177..977695 | - | 519 | WP_025302449.1 | non-heme ferritin | - |
AM354_RS04620 | 978041..978271 | + | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
AM354_RS04625 | 978303..979256 | - | 954 | WP_033646426.1 | prolyl aminopeptidase | - |
AM354_RS04630 | 979449..979874 | - | 426 | WP_033653830.1 | RNA polymerase-binding protein DksA | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T95473 NZ_CP026702:c975032-974936 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT95473 NZ_CP026702:974936-975076 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG