Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 941334..941474 | Replicon | chromosome |
Accession | NZ_CP026050 | ||
Organism | Serratia marcescens strain FDAARGOS_65 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 941334..941430 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 941334..941474 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MC51_RS04200 | 936917..937252 | - | 336 | WP_047568023.1 | hypothetical protein | - |
MC51_RS04205 | 937296..937601 | - | 306 | WP_047568025.1 | hypothetical protein | - |
MC51_RS04210 | 937773..937991 | - | 219 | WP_072021565.1 | hypothetical protein | - |
MC51_RS04215 | 938219..939418 | - | 1200 | WP_033638117.1 | trans-2-enoyl-CoA reductase family protein | - |
MC51_RS04220 | 939602..939952 | - | 351 | WP_047568027.1 | DUF4377 domain-containing protein | - |
MC51_RS24970 | 940245..940409 | + | 165 | WP_154609290.1 | hypothetical protein | - |
MC51_RS04225 | 940473..940691 | + | 219 | WP_033638114.1 | hypothetical protein | - |
MC51_RS04230 | 940688..941092 | - | 405 | WP_047568029.1 | hypothetical protein | - |
- | 941334..941430 | - | 97 | - | - | Toxin |
- | 941334..941474 | + | 141 | - | - | Antitoxin |
MC51_RS04235 | 941572..941913 | - | 342 | WP_025302452.1 | YebY family protein | - |
MC51_RS04240 | 941983..942864 | - | 882 | WP_047568032.1 | copper homeostasis membrane protein CopD | - |
MC51_RS04245 | 942867..943250 | - | 384 | WP_004940886.1 | CopC domain-containing protein YobA | - |
MC51_RS04250 | 943575..944093 | - | 519 | WP_025302449.1 | non-heme ferritin | - |
MC51_RS04255 | 944439..944669 | + | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
MC51_RS04260 | 944701..945654 | - | 954 | WP_033646426.1 | prolyl aminopeptidase | - |
MC51_RS04265 | 945847..946272 | - | 426 | WP_033653830.1 | RNA polymerase-binding protein DksA | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T92938 NZ_CP026050:c941430-941334 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT92938 NZ_CP026050:941334-941474 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG