Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3329681..3329824 | Replicon | chromosome |
Accession | NZ_CP026045 | ||
Organism | Citrobacter freundii strain FDAARGOS_61 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3329716..3329819 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3329681..3329824 (-) |
Genomic Context
Location: 3327951..3328325 (375 bp)
Type: Others
Protein ID: WP_047410546.1
Type: Others
Protein ID: WP_047410546.1
Location: 3328329..3329201 (873 bp)
Type: Others
Protein ID: WP_043016685.1
Type: Others
Protein ID: WP_043016685.1
Location: 3329222..3329560 (339 bp)
Type: Others
Protein ID: WP_043016684.1
Type: Others
Protein ID: WP_043016684.1
Location: 3329716..3329819 (104 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 3330129..3331385 (1257 bp)
Type: Others
Protein ID: WP_047410548.1
Type: Others
Protein ID: WP_047410548.1
Location: 3331487..3332128 (642 bp)
Type: Others
Protein ID: WP_047410550.1
Type: Others
Protein ID: WP_047410550.1
Location: 3326128..3326790 (663 bp)
Type: Others
Protein ID: WP_043016687.1
Type: Others
Protein ID: WP_043016687.1
Location: 3326814..3327470 (657 bp)
Type: Others
Protein ID: WP_043016686.1
Type: Others
Protein ID: WP_043016686.1
Location: 3327577..3327807 (231 bp)
Type: Others
Protein ID: WP_003034925.1
Type: Others
Protein ID: WP_003034925.1
Location: 3329681..3329824 (144 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 3332129..3332320 (192 bp)
Type: Others
Protein ID: WP_016152779.1
Type: Others
Protein ID: WP_016152779.1
Location: 3332423..3332659 (237 bp)
Type: Others
Protein ID: WP_029139506.1
Type: Others
Protein ID: WP_029139506.1
Location: 3332760..3334205 (1446 bp)
Type: Others
Protein ID: WP_123915346.1
Type: Others
Protein ID: WP_123915346.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MC47_RS16125 | 3326128..3326790 | - | 663 | WP_043016687.1 | exodeoxyribonuclease X | - |
MC47_RS16130 | 3326814..3327470 | - | 657 | WP_043016686.1 | carbon-nitrogen hydrolase family protein | - |
MC47_RS16135 | 3327577..3327807 | - | 231 | WP_003034925.1 | DNA polymerase III subunit theta | - |
MC47_RS16140 | 3327951..3328325 | + | 375 | WP_047410546.1 | CopC domain-containing protein YobA | - |
MC47_RS16145 | 3328329..3329201 | + | 873 | WP_043016685.1 | copper homeostasis membrane protein CopD | - |
MC47_RS16150 | 3329222..3329560 | + | 339 | WP_043016684.1 | YebY family protein | - |
- | 3329681..3329824 | - | 144 | - | - | Antitoxin |
- | 3329716..3329819 | + | 104 | - | - | Toxin |
MC47_RS16155 | 3330129..3331385 | + | 1257 | WP_047410548.1 | hypothetical protein | - |
MC47_RS16160 | 3331487..3332128 | + | 642 | WP_047410550.1 | protein-serine/threonine phosphatase | - |
MC47_RS16165 | 3332129..3332320 | - | 192 | WP_016152779.1 | YebW family protein | - |
MC47_RS16170 | 3332423..3332659 | - | 237 | WP_029139506.1 | DUF1480 family protein | - |
MC47_RS16175 | 3332760..3334205 | - | 1446 | WP_123915346.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
No matching records found |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T92909 NZ_CP026045:3329716-3329819 [Citrobacter freundii]
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT92909 NZ_CP026045:c3329824-3329681 [Citrobacter freundii]
CACATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT
CACATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT