Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1989888..1990032 | Replicon | chromosome |
Accession | NZ_CP026013 | ||
Organism | Klebsiella variicola strain 13450 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1989924..1990026 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1989888..1990032 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
C2D62_RS09580 | 1985744..1986403 | - | 660 | WP_022066251.1 | exodeoxyribonuclease X | - |
C2D62_RS09585 | 1986482..1986712 | - | 231 | WP_012541260.1 | DNA polymerase III subunit theta | - |
C2D62_RS09590 | 1986826..1987200 | + | 375 | WP_008804269.1 | CopC domain-containing protein YobA | - |
C2D62_RS09595 | 1987204..1988073 | + | 870 | WP_012541262.1 | copper homeostasis membrane protein CopD | - |
C2D62_RS09600 | 1988090..1988464 | + | 375 | WP_181646003.1 | YebY family protein | - |
C2D62_RS09605 | 1988534..1989742 | + | 1209 | WP_001352368.1 | IS4-like element ISVsa5 family transposase | - |
- | 1989888..1990032 | - | 145 | - | - | Antitoxin |
- | 1989924..1990026 | + | 103 | - | - | Toxin |
C2D62_RS09610 | 1990411..1990554 | - | 144 | WP_046621074.1 | Ecr family regulatory small membrane protein | - |
C2D62_RS09615 | 1990658..1991647 | - | 990 | WP_032691211.1 | VirK/YbjX family protein | - |
C2D62_RS09620 | 1991783..1992436 | + | 654 | WP_022066249.1 | protein-serine/threonine phosphatase | - |
C2D62_RS09625 | 1992433..1992624 | - | 192 | WP_002911395.1 | YebW family protein | - |
C2D62_RS09630 | 1992722..1992961 | - | 240 | WP_002911393.1 | YebV family protein | - |
C2D62_RS09635 | 1993077..1994510 | - | 1434 | WP_012967754.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 1988534..1989742 | 1208 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T92678 NZ_CP026013:1989924-1990026 [Klebsiella variicola]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 145 bp
>AT92678 NZ_CP026013:c1990032-1989888 [Klebsiella variicola]
ACCGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ACCGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT