Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2051395..2051540 | Replicon | chromosome |
Accession | NZ_CP025146 | ||
Organism | Klebsiella pneumoniae strain KP1766 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2051431..2051533 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2051395..2051540 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CXB26_RS10570 | 2046525..2048585 | + | 2061 | WP_004148850.1 | oligopeptidase B | - |
CXB26_RS10575 | 2048589..2049248 | - | 660 | WP_032435029.1 | exodeoxyribonuclease X | - |
CXB26_RS10580 | 2049327..2049557 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
CXB26_RS10585 | 2049670..2050044 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
CXB26_RS10590 | 2050048..2050917 | + | 870 | WP_032435031.1 | copper homeostasis membrane protein CopD | - |
CXB26_RS10595 | 2050934..2051272 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2051395..2051540 | - | 146 | - | - | Antitoxin |
- | 2051431..2051533 | + | 103 | - | - | Toxin |
CXB26_RS29480 | 2051908..2052051 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
CXB26_RS10605 | 2052156..2053124 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
CXB26_RS10610 | 2053281..2053934 | + | 654 | WP_004891053.1 | protein-serine/threonine phosphatase | - |
CXB26_RS10615 | 2053931..2054122 | - | 192 | WP_002911395.1 | YebW family protein | - |
CXB26_RS10620 | 2054220..2054459 | - | 240 | WP_002911393.1 | YebV family protein | - |
CXB26_RS10625 | 2054575..2056008 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1978694..2070003 | 91309 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T89836 NZ_CP025146:2051431-2051533 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT89836 NZ_CP025146:c2051540-2051395 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT