Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1917994..1918108 | Replicon | chromosome |
Accession | NZ_CP023962 | ||
Organism | Yersinia frederiksenii strain FDAARGOS_417 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1917997..1918089 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1917994..1918108 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CRN74_RS08855 | 1913304..1913798 | + | 495 | WP_098904646.1 | hypothetical protein | - |
CRN74_RS08860 | 1913791..1914102 | + | 312 | WP_098904647.1 | hypothetical protein | - |
CRN74_RS08865 | 1914789..1915055 | + | 267 | WP_098905259.1 | antitoxin | - |
CRN74_RS08870 | 1915055..1915810 | + | 756 | WP_098904648.1 | hypothetical protein | - |
CRN74_RS23485 | 1916132..1916482 | + | 351 | WP_192941420.1 | hypothetical protein | - |
CRN74_RS08885 | 1916570..1916839 | + | 270 | WP_098904650.1 | excisionase | - |
CRN74_RS08890 | 1916814..1917920 | + | 1107 | WP_192941421.1 | tyrosine-type recombinase/integrase | - |
- | 1917994..1918108 | + | 115 | - | - | Antitoxin |
- | 1917997..1918089 | - | 93 | - | - | Toxin |
CRN74_RS08895 | 1918266..1918607 | - | 342 | WP_098904651.1 | YebY family protein | - |
CRN74_RS08900 | 1918705..1919589 | - | 885 | WP_098904652.1 | copper homeostasis membrane protein CopD | - |
CRN74_RS08905 | 1919591..1919977 | - | 387 | WP_050080589.1 | CopC domain-containing protein YobA | - |
CRN74_RS08910 | 1920371..1920880 | - | 510 | WP_019210237.1 | non-heme ferritin | - |
CRN74_RS08915 | 1921274..1921507 | + | 234 | WP_050285735.1 | DNA polymerase III subunit theta | - |
CRN74_RS08920 | 1921553..1922509 | - | 957 | WP_050285736.1 | prolyl aminopeptidase | - |
CRN74_RS23490 | 1922792..1922944 | + | 153 | WP_155410999.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1860516..1923687 | 63171 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 93 bp
>T86493 NZ_CP023962:c1918089-1917997 [Yersinia frederiksenii]
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTTTTTTT
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTTTTTTT
Antitoxin
Download Length: 115 bp
>AT86493 NZ_CP023962:1917994-1918108 [Yersinia frederiksenii]
GATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGG
CATTAACGTAGGCTTACTCAGCCGTACCCTTTAAG
GATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGG
CATTAACGTAGGCTTACTCAGCCGTACCCTTTAAG