Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2532475..2532620 | Replicon | chromosome |
Accession | NZ_CP023487 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2532511..2532613 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2532475..2532620 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AN663_RS12805 | 2527605..2529665 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
AN663_RS12810 | 2529669..2530328 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
AN663_RS12815 | 2530407..2530637 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
AN663_RS12820 | 2530750..2531124 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
AN663_RS12825 | 2531128..2531997 | + | 870 | WP_023282759.1 | copper homeostasis membrane protein CopD | - |
AN663_RS12830 | 2532014..2532352 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2532475..2532620 | - | 146 | - | - | Antitoxin |
- | 2532511..2532613 | + | 103 | - | - | Toxin |
AN663_RS30085 | 2532988..2533131 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
AN663_RS12840 | 2533236..2534204 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
AN663_RS12845 | 2534361..2535014 | + | 654 | WP_032418800.1 | protein-serine/threonine phosphatase | - |
AN663_RS12850 | 2535011..2535202 | - | 192 | WP_002911395.1 | YebW family protein | - |
AN663_RS12855 | 2535300..2535539 | - | 240 | WP_002911393.1 | YebV family protein | - |
AN663_RS12860 | 2535655..2537088 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T81372 NZ_CP023487:2532511-2532613 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT81372 NZ_CP023487:c2532620-2532475 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT