Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2229319..2229465 | Replicon | chromosome |
Accession | NZ_CP023184 | ||
Organism | Yersinia ruckeri strain NHV_3758 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2229323..2229416 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2229319..2229465 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CLC90_RS10150 | 2224549..2225688 | + | 1140 | WP_096823472.1 | hypothetical protein | - |
CLC90_RS10155 | 2225685..2226113 | + | 429 | WP_096823473.1 | hypothetical protein | - |
CLC90_RS17800 | 2226178..2227014 | + | 837 | WP_202976849.1 | hypothetical protein | - |
CLC90_RS17780 | 2227158..2227331 | + | 174 | WP_170854680.1 | hypothetical protein | - |
CLC90_RS10165 | 2227522..2227776 | + | 255 | WP_193553624.1 | hypothetical protein | - |
CLC90_RS10170 | 2227893..2228162 | + | 270 | WP_096823474.1 | excisionase | - |
CLC90_RS10175 | 2228137..2229246 | + | 1110 | WP_162486764.1 | tyrosine-type recombinase/integrase | - |
- | 2229319..2229465 | + | 147 | - | - | Antitoxin |
- | 2229323..2229416 | - | 94 | - | - | Toxin |
CLC90_RS10180 | 2229575..2229916 | - | 342 | WP_004721721.1 | YebY family protein | - |
CLC90_RS10185 | 2230011..2230895 | - | 885 | WP_004721723.1 | copper homeostasis membrane protein CopD | - |
CLC90_RS10190 | 2230897..2231283 | - | 387 | WP_038243346.1 | CopC domain-containing protein YobA | - |
CLC90_RS10195 | 2231688..2232203 | - | 516 | WP_004721727.1 | non-heme ferritin | - |
CLC90_RS10200 | 2232606..2232836 | + | 231 | WP_038243344.1 | DNA polymerase III subunit theta | - |
CLC90_RS10205 | 2232959..2233909 | - | 951 | WP_004721733.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2171397..2229916 | 58519 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 94 bp
>T80579 NZ_CP023184:c2229416-2229323 [Yersinia ruckeri]
TAAGCCTGCATGAAATGCCAACTTTTAGCGCACGGCTCTATCCCAAGAGCCATTTCCCTGGACCGAATATAGGATTCGTA
TTCGGTCTTTTTTT
TAAGCCTGCATGAAATGCCAACTTTTAGCGCACGGCTCTATCCCAAGAGCCATTTCCCTGGACCGAATATAGGATTCGTA
TTCGGTCTTTTTTT
Antitoxin
Download Length: 147 bp
>AT80579 NZ_CP023184:2229319-2229465 [Yersinia ruckeri]
AGATAAAAAAAGACCGAATACGAATCCTATATTCGGTCCAGGGAAATGGCTCTTGGGATAGAGCCGTGCGCTAAAAGTTG
GCATTTCATGCAGGCTTATTAAGCCGTACCACTTAAGCGTAGTAGACGACCCACATTTTACCAATTT
AGATAAAAAAAGACCGAATACGAATCCTATATTCGGTCCAGGGAAATGGCTCTTGGGATAGAGCCGTGCGCTAAAAGTTG
GCATTTCATGCAGGCTTATTAAGCCGTACCACTTAAGCGTAGTAGACGACCCACATTTTACCAATTT