Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2014279..2014424 | Replicon | chromosome |
Accession | NZ_CP022691 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2014315..2014417 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2014279..2014424 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CI103_RS09775 | 2009409..2011469 | + | 2061 | WP_032422099.1 | oligopeptidase B | - |
CI103_RS09780 | 2011473..2012132 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
CI103_RS09785 | 2012211..2012441 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
CI103_RS09790 | 2012554..2012928 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
CI103_RS09795 | 2012932..2013801 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
CI103_RS09800 | 2013818..2014156 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2014279..2014424 | - | 146 | - | - | Antitoxin |
- | 2014315..2014417 | + | 103 | - | - | Toxin |
CI103_RS09805 | 2014792..2014935 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
CI103_RS09810 | 2015040..2016008 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
CI103_RS09815 | 2016165..2016818 | + | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
CI103_RS09820 | 2016815..2017006 | - | 192 | WP_002911395.1 | YebW family protein | - |
CI103_RS09825 | 2017104..2017343 | - | 240 | WP_002911393.1 | YebV family protein | - |
CI103_RS09830 | 2017459..2018892 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T79590 NZ_CP022691:2014315-2014417 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT79590 NZ_CP022691:c2014424-2014279 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT