Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 5181718..5181863 | Replicon | chromosome |
Accession | NZ_CP022611 | ||
Organism | Klebsiella pneumoniae strain CDC 0106 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 5181754..5181856 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 5181718..5181863 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CHC10_RS25885 | 5176848..5178908 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
CHC10_RS25890 | 5178912..5179571 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
CHC10_RS25895 | 5179650..5179880 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
CHC10_RS25900 | 5179993..5180367 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
CHC10_RS25905 | 5180371..5181240 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
CHC10_RS25910 | 5181257..5181595 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 5181718..5181863 | - | 146 | - | - | Antitoxin |
- | 5181754..5181856 | + | 103 | - | - | Toxin |
CHC10_RS30380 | 5182232..5182375 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
CHC10_RS25920 | 5182480..5183448 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
CHC10_RS25925 | 5183605..5184257 | + | 653 | Protein_4908 | protein-serine/threonine phosphatase | - |
CHC10_RS25930 | 5184254..5184445 | - | 192 | WP_002911395.1 | YebW family protein | - |
CHC10_RS25935 | 5184543..5184782 | - | 240 | WP_002911393.1 | YebV family protein | - |
CHC10_RS25940 | 5184898..5186331 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T79428 NZ_CP022611:5181754-5181856 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT79428 NZ_CP022611:c5181863-5181718 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT